Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630062_a_at:

>probe:Drosophila_2:1630062_a_at:316:125; Interrogation_Position=128; Antisense; AGCCGATGGTAATTGCGGGCCGCAT
>probe:Drosophila_2:1630062_a_at:483:121; Interrogation_Position=161; Antisense; AGCGTGAGCGCCTGATCGGCATGTC
>probe:Drosophila_2:1630062_a_at:447:323; Interrogation_Position=197; Antisense; GCGCCTGGCGCAAACAGTGGCTGAA
>probe:Drosophila_2:1630062_a_at:533:75; Interrogation_Position=227; Antisense; AGGAGCTGCACCATGGACCCCGCAA
>probe:Drosophila_2:1630062_a_at:539:13; Interrogation_Position=28; Antisense; ATTATACAATTGTTGGCGTTTTCCA
>probe:Drosophila_2:1630062_a_at:5:303; Interrogation_Position=308; Antisense; CCCTCGACAAGGTCTGCAATGTTTT
>probe:Drosophila_2:1630062_a_at:696:361; Interrogation_Position=323; Antisense; GCAATGTTTTGGAACCCGTCCTGGG
>probe:Drosophila_2:1630062_a_at:19:505; Interrogation_Position=340; Antisense; GTCCTGGGCTTTCAGCGCGCGTACA
>probe:Drosophila_2:1630062_a_at:365:665; Interrogation_Position=361; Antisense; TACACCGTGCGCTTCTGGACCGGAA
>probe:Drosophila_2:1630062_a_at:334:715; Interrogation_Position=373; Antisense; TTCTGGACCGGAAAGGCTCTGCTCG
>probe:Drosophila_2:1630062_a_at:724:659; Interrogation_Position=401; Antisense; TAACCGGAATCTACGCCGGCGCCTA
>probe:Drosophila_2:1630062_a_at:494:577; Interrogation_Position=418; Antisense; GGCGCCTACTACTTCAAGTACAACC
>probe:Drosophila_2:1630062_a_at:669:589; Interrogation_Position=47; Antisense; TTTCCAACGTCCACATCGCAAAGTT
>probe:Drosophila_2:1630062_a_at:214:171; Interrogation_Position=78; Antisense; CAAACGGTCCAAAATGGTAGCTGGT

Paste this into a BLAST search page for me
AGCCGATGGTAATTGCGGGCCGCATAGCGTGAGCGCCTGATCGGCATGTCGCGCCTGGCGCAAACAGTGGCTGAAAGGAGCTGCACCATGGACCCCGCAAATTATACAATTGTTGGCGTTTTCCACCCTCGACAAGGTCTGCAATGTTTTGCAATGTTTTGGAACCCGTCCTGGGGTCCTGGGCTTTCAGCGCGCGTACATACACCGTGCGCTTCTGGACCGGAATTCTGGACCGGAAAGGCTCTGCTCGTAACCGGAATCTACGCCGGCGCCTAGGCGCCTACTACTTCAAGTACAACCTTTCCAACGTCCACATCGCAAAGTTCAAACGGTCCAAAATGGTAGCTGGT

Full Affymetrix probeset data:

Annotations for 1630062_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime