FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630064_at:

>probe:Drosophila_2:1630064_at:402:267; Interrogation_Position=4293; Antisense; CAGTGCTCATGTCCCAGTGGCTCAG
>probe:Drosophila_2:1630064_at:14:433; Interrogation_Position=4336; Antisense; GAGTCCATCCAGCTGGTGCTGTTCA
>probe:Drosophila_2:1630064_at:197:509; Interrogation_Position=4351; Antisense; GTGCTGTTCATAATGGCCACCAGTT
>probe:Drosophila_2:1630064_at:696:719; Interrogation_Position=4381; Antisense; TTCCTGGTCAGCATATTTGTGGTCT
>probe:Drosophila_2:1630064_at:379:519; Interrogation_Position=4399; Antisense; GTGGTCTATGTCATGCTGAAGCGAA
>probe:Drosophila_2:1630064_at:42:377; Interrogation_Position=4416; Antisense; GAAGCGAAACCGGAACCTCAAGGCG
>probe:Drosophila_2:1630064_at:693:653; Interrogation_Position=4433; Antisense; TCAAGGCGGCGAATCCCTATTTGAA
>probe:Drosophila_2:1630064_at:184:71; Interrogation_Position=4467; Antisense; AGGCGACAAGCCTGTGGACTACTCC
>probe:Drosophila_2:1630064_at:308:577; Interrogation_Position=4509; Antisense; GGCCGCCGACATGGACAGCAAGAAG
>probe:Drosophila_2:1630064_at:676:483; Interrogation_Position=4545; Antisense; GTAGGCATTCCGTTGTTGAGTTATC
>probe:Drosophila_2:1630064_at:250:427; Interrogation_Position=4627; Antisense; GAGATCAGAGGCCTTGATTCTGCCC
>probe:Drosophila_2:1630064_at:183:3; Interrogation_Position=4643; Antisense; ATTCTGCCCCAACTAAGCCAAAAGG
>probe:Drosophila_2:1630064_at:229:85; Interrogation_Position=4670; Antisense; AGTGCGACTAGAGGGAACCCACTTT
>probe:Drosophila_2:1630064_at:459:43; Interrogation_Position=4704; Antisense; ATCGCATATGTTCTAGCAACCTAAG

Paste this into a BLAST search page for me
CAGTGCTCATGTCCCAGTGGCTCAGGAGTCCATCCAGCTGGTGCTGTTCAGTGCTGTTCATAATGGCCACCAGTTTTCCTGGTCAGCATATTTGTGGTCTGTGGTCTATGTCATGCTGAAGCGAAGAAGCGAAACCGGAACCTCAAGGCGTCAAGGCGGCGAATCCCTATTTGAAAGGCGACAAGCCTGTGGACTACTCCGGCCGCCGACATGGACAGCAAGAAGGTAGGCATTCCGTTGTTGAGTTATCGAGATCAGAGGCCTTGATTCTGCCCATTCTGCCCCAACTAAGCCAAAAGGAGTGCGACTAGAGGGAACCCACTTTATCGCATATGTTCTAGCAACCTAAG

Full Affymetrix probeset data:

Annotations for 1630064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720