FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630065_at:

>probe:Drosophila_2:1630065_at:441:93; Interrogation_Position=1032; Antisense; AGTTCTGCGATTCCAGAGTCTGCAC
>probe:Drosophila_2:1630065_at:337:687; Interrogation_Position=1068; Antisense; TATATCTCAAGCCACCGAAGGTCGT
>probe:Drosophila_2:1630065_at:342:389; Interrogation_Position=1108; Antisense; GAAACGAGTGGTCATGCCGCCAAAT
>probe:Drosophila_2:1630065_at:465:401; Interrogation_Position=1175; Antisense; GACATTTTGGATTGCTCCGGCTGCA
>probe:Drosophila_2:1630065_at:350:545; Interrogation_Position=1213; Antisense; GGATAAGTGCTCACCGGGCTGCTAC
>probe:Drosophila_2:1630065_at:529:335; Interrogation_Position=1230; Antisense; GCTGCTACAGTTACTACTGTCCCAA
>probe:Drosophila_2:1630065_at:513:207; Interrogation_Position=1258; Antisense; AAGCTGTGCCTTCATGAATATCGAG
>probe:Drosophila_2:1630065_at:350:403; Interrogation_Position=1283; Antisense; GACTTTTGTGGCATTTATCCTGGAG
>probe:Drosophila_2:1630065_at:133:181; Interrogation_Position=1373; Antisense; AAACAATTTGTCTCTCTGCAACTTA
>probe:Drosophila_2:1630065_at:380:543; Interrogation_Position=879; Antisense; GGATATACCCCAGTTTGAGGCCATC
>probe:Drosophila_2:1630065_at:355:719; Interrogation_Position=893; Antisense; TTGAGGCCATCTACGGAACAGTCGG
>probe:Drosophila_2:1630065_at:330:267; Interrogation_Position=911; Antisense; CAGTCGGCGGCTAATGAAGTCTTTC
>probe:Drosophila_2:1630065_at:8:307; Interrogation_Position=947; Antisense; CCTCCACCGCAATGCTGTTTTGTAA
>probe:Drosophila_2:1630065_at:62:477; Interrogation_Position=963; Antisense; GTTTTGTAAAGAGCCCTCGCATCTG

Paste this into a BLAST search page for me
AGTTCTGCGATTCCAGAGTCTGCACTATATCTCAAGCCACCGAAGGTCGTGAAACGAGTGGTCATGCCGCCAAATGACATTTTGGATTGCTCCGGCTGCAGGATAAGTGCTCACCGGGCTGCTACGCTGCTACAGTTACTACTGTCCCAAAAGCTGTGCCTTCATGAATATCGAGGACTTTTGTGGCATTTATCCTGGAGAAACAATTTGTCTCTCTGCAACTTAGGATATACCCCAGTTTGAGGCCATCTTGAGGCCATCTACGGAACAGTCGGCAGTCGGCGGCTAATGAAGTCTTTCCCTCCACCGCAATGCTGTTTTGTAAGTTTTGTAAAGAGCCCTCGCATCTG

Full Affymetrix probeset data:

Annotations for 1630065_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720