Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630066_at:

>probe:Drosophila_2:1630066_at:176:583; Interrogation_Position=1169; Antisense; TGGCGCACCCGAATGTCAAGGTTTT
>probe:Drosophila_2:1630066_at:183:697; Interrogation_Position=1191; Antisense; TTTCATTGCCCATGGAGGACTCTTC
>probe:Drosophila_2:1630066_at:553:71; Interrogation_Position=1226; Antisense; AGGCGGTGTACAATGGTGTTCCCAT
>probe:Drosophila_2:1630066_at:203:565; Interrogation_Position=1255; Antisense; GGAATGCCAGTCTACTGTGATCAGC
>probe:Drosophila_2:1630066_at:314:45; Interrogation_Position=1313; Antisense; ATGCACTGGGACTGGATTACCGGAA
>probe:Drosophila_2:1630066_at:265:327; Interrogation_Position=1356; Antisense; GCGAGGTCTGCTGATGGAACTGATT
>probe:Drosophila_2:1630066_at:58:267; Interrogation_Position=1404; Antisense; CATTAAGAAGGCCTCCCGGATATTC
>probe:Drosophila_2:1630066_at:692:145; Interrogation_Position=1440; Antisense; ACTCGGTGCCATGGATACGGCCATA
>probe:Drosophila_2:1630066_at:299:41; Interrogation_Position=1505; Antisense; ATCTGGTGGCCGCTGGTGTACATCT
>probe:Drosophila_2:1630066_at:532:533; Interrogation_Position=1519; Antisense; GGTGTACATCTACCCTGGTACCAGT
>probe:Drosophila_2:1630066_at:339:151; Interrogation_Position=1556; Antisense; ACATTGTGGGTCTAGGTCTCGCTGT
>probe:Drosophila_2:1630066_at:256:449; Interrogation_Position=1581; Antisense; GATCCTGTTGCCAATCGTAGTTCTA
>probe:Drosophila_2:1630066_at:34:487; Interrogation_Position=1597; Antisense; GTAGTTCTAATCCTGATCTGCCGCA
>probe:Drosophila_2:1630066_at:367:203; Interrogation_Position=1630; Antisense; AAGCCGAAGAGCACTCCGACGAAGA

Paste this into a BLAST search page for me
TGGCGCACCCGAATGTCAAGGTTTTTTTCATTGCCCATGGAGGACTCTTCAGGCGGTGTACAATGGTGTTCCCATGGAATGCCAGTCTACTGTGATCAGCATGCACTGGGACTGGATTACCGGAAGCGAGGTCTGCTGATGGAACTGATTCATTAAGAAGGCCTCCCGGATATTCACTCGGTGCCATGGATACGGCCATAATCTGGTGGCCGCTGGTGTACATCTGGTGTACATCTACCCTGGTACCAGTACATTGTGGGTCTAGGTCTCGCTGTGATCCTGTTGCCAATCGTAGTTCTAGTAGTTCTAATCCTGATCTGCCGCAAAGCCGAAGAGCACTCCGACGAAGA

Full Affymetrix probeset data:

Annotations for 1630066_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime