FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630069_at:

>probe:Drosophila_2:1630069_at:149:229; Interrogation_Position=1922; Antisense; AATGGCAGTGGCTCTGGTCTGCAAC
>probe:Drosophila_2:1630069_at:215:631; Interrogation_Position=1993; Antisense; TCCGTCGCATAATCAAACCCAACAG
>probe:Drosophila_2:1630069_at:484:189; Interrogation_Position=2040; Antisense; AACATCTGCAATCCCAGCCAGGAAA
>probe:Drosophila_2:1630069_at:119:165; Interrogation_Position=2062; Antisense; AAATCGATCCAGTACCATTTCGCGC
>probe:Drosophila_2:1630069_at:60:35; Interrogation_Position=2091; Antisense; ATCACCTGCCGCTTATTGACTTTGA
>probe:Drosophila_2:1630069_at:138:403; Interrogation_Position=2108; Antisense; GACTTTGAGCATCCTATTGTGGCGG
>probe:Drosophila_2:1630069_at:140:691; Interrogation_Position=2122; Antisense; TATTGTGGCGGCTGAGCTCCCAGAT
>probe:Drosophila_2:1630069_at:419:273; Interrogation_Position=2155; Antisense; CTTGGGCAGCATTCGGCAGGATTAT
>probe:Drosophila_2:1630069_at:662:187; Interrogation_Position=2191; Antisense; AACACCTGCGGATGAGCACTATCGT
>probe:Drosophila_2:1630069_at:679:683; Interrogation_Position=2210; Antisense; TATCGTTATCCGAAGAGCGCCAATA
>probe:Drosophila_2:1630069_at:469:303; Interrogation_Position=2275; Antisense; CCGCTTTCCGGTTGAGGATCTGATA
>probe:Drosophila_2:1630069_at:70:519; Interrogation_Position=2309; Antisense; GTGGACGATGCTCTCTAACCACTAA
>probe:Drosophila_2:1630069_at:603:215; Interrogation_Position=2356; Antisense; AAGTTAAGGCTAGCTGTTCCGCATT
>probe:Drosophila_2:1630069_at:31:471; Interrogation_Position=2371; Antisense; GTTCCGCATTGCAAGGACTTACCTT

Paste this into a BLAST search page for me
AATGGCAGTGGCTCTGGTCTGCAACTCCGTCGCATAATCAAACCCAACAGAACATCTGCAATCCCAGCCAGGAAAAAATCGATCCAGTACCATTTCGCGCATCACCTGCCGCTTATTGACTTTGAGACTTTGAGCATCCTATTGTGGCGGTATTGTGGCGGCTGAGCTCCCAGATCTTGGGCAGCATTCGGCAGGATTATAACACCTGCGGATGAGCACTATCGTTATCGTTATCCGAAGAGCGCCAATACCGCTTTCCGGTTGAGGATCTGATAGTGGACGATGCTCTCTAACCACTAAAAGTTAAGGCTAGCTGTTCCGCATTGTTCCGCATTGCAAGGACTTACCTT

Full Affymetrix probeset data:

Annotations for 1630069_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720