FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630070_at:

>probe:Drosophila_2:1630070_at:629:223; Interrogation_Position=1008; Antisense; AAGGATTGCGCTCCTCTTTATGCAA
>probe:Drosophila_2:1630070_at:368:403; Interrogation_Position=1084; Antisense; GACTTAATGCTCTTCAGCTCGGTGA
>probe:Drosophila_2:1630070_at:175:607; Interrogation_Position=1106; Antisense; TGAGTTCTTTCCGTGTTTTGACTTT
>probe:Drosophila_2:1630070_at:571:611; Interrogation_Position=1124; Antisense; TGACTTTTTTGTGCACTGTAGCCAA
>probe:Drosophila_2:1630070_at:713:189; Interrogation_Position=574; Antisense; AACATAGGATTCGACTCACTCTGCT
>probe:Drosophila_2:1630070_at:436:151; Interrogation_Position=632; Antisense; ACATTCTGGCCGTGCGACTGGACAA
>probe:Drosophila_2:1630070_at:309:1; Interrogation_Position=660; Antisense; CGGTCGGTTAATCACTACTTCTGGT
>probe:Drosophila_2:1630070_at:19:165; Interrogation_Position=711; Antisense; AAATATCCGCTATCACATGACCATC
>probe:Drosophila_2:1630070_at:290:175; Interrogation_Position=749; Antisense; AAACCGTGGAGCGTCTACTTTGCAA
>probe:Drosophila_2:1630070_at:433:203; Interrogation_Position=772; Antisense; AAGCCGATTTCGGTGCAGATCTTCT
>probe:Drosophila_2:1630070_at:437:405; Interrogation_Position=813; Antisense; GACTGCCAATTTCTATGCCATTGCT
>probe:Drosophila_2:1630070_at:561:49; Interrogation_Position=827; Antisense; ATGCCATTGCTGTGTTATCTGACGA
>probe:Drosophila_2:1630070_at:531:691; Interrogation_Position=911; Antisense; TATTGTGCTACTATGCCGGTGAGGT
>probe:Drosophila_2:1630070_at:631:119; Interrogation_Position=965; Antisense; AGCTGTACAAGACCTCCTGGGTGGA

Paste this into a BLAST search page for me
AAGGATTGCGCTCCTCTTTATGCAAGACTTAATGCTCTTCAGCTCGGTGATGAGTTCTTTCCGTGTTTTGACTTTTGACTTTTTTGTGCACTGTAGCCAAAACATAGGATTCGACTCACTCTGCTACATTCTGGCCGTGCGACTGGACAACGGTCGGTTAATCACTACTTCTGGTAAATATCCGCTATCACATGACCATCAAACCGTGGAGCGTCTACTTTGCAAAAGCCGATTTCGGTGCAGATCTTCTGACTGCCAATTTCTATGCCATTGCTATGCCATTGCTGTGTTATCTGACGATATTGTGCTACTATGCCGGTGAGGTAGCTGTACAAGACCTCCTGGGTGGA

Full Affymetrix probeset data:

Annotations for 1630070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720