FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630071_at:

>probe:Drosophila_2:1630071_at:706:173; Interrogation_Position=104; Antisense; AAACCGATGAGCGTGGAAATGAACA
>probe:Drosophila_2:1630071_at:463:187; Interrogation_Position=125; Antisense; AACACGGCGGACAATCTGATCACGG
>probe:Drosophila_2:1630071_at:165:41; Interrogation_Position=138; Antisense; ATCTGATCACGGGTGCCAGGCGCCA
>probe:Drosophila_2:1630071_at:406:577; Interrogation_Position=156; Antisense; GGCGCCAGCGAATGATGGAGCTCTT
>probe:Drosophila_2:1630071_at:625:583; Interrogation_Position=171; Antisense; TGGAGCTCTTCCAGGAGGACCGCGC
>probe:Drosophila_2:1630071_at:511:343; Interrogation_Position=219; Antisense; GCTTCGGACTGAGCTGCATCAAGGC
>probe:Drosophila_2:1630071_at:544:609; Interrogation_Position=228; Antisense; TGAGCTGCATCAAGGCCCCGGACTG
>probe:Drosophila_2:1630071_at:445:683; Interrogation_Position=254; Antisense; TATCCCTGCTGCACTCCTTTCGAGT
>probe:Drosophila_2:1630071_at:294:557; Interrogation_Position=27; Antisense; GGACTTGTCTCTCCCTGCTCAACAA
>probe:Drosophila_2:1630071_at:667:693; Interrogation_Position=271; Antisense; TTTCGAGTGCTCCAAGGCCAAGTTC
>probe:Drosophila_2:1630071_at:159:653; Interrogation_Position=45; Antisense; TCAACAATCGCGACCTGCTGAAGAC
>probe:Drosophila_2:1630071_at:336:131; Interrogation_Position=57; Antisense; ACCTGCTGAAGACTCCGTCCGGCAA
>probe:Drosophila_2:1630071_at:457:503; Interrogation_Position=73; Antisense; GTCCGGCAACTCCATTGTGAACTTC
>probe:Drosophila_2:1630071_at:419:709; Interrogation_Position=87; Antisense; TTGTGAACTTCCTGGTGAAACCGAT

Paste this into a BLAST search page for me
AAACCGATGAGCGTGGAAATGAACAAACACGGCGGACAATCTGATCACGGATCTGATCACGGGTGCCAGGCGCCAGGCGCCAGCGAATGATGGAGCTCTTTGGAGCTCTTCCAGGAGGACCGCGCGCTTCGGACTGAGCTGCATCAAGGCTGAGCTGCATCAAGGCCCCGGACTGTATCCCTGCTGCACTCCTTTCGAGTGGACTTGTCTCTCCCTGCTCAACAATTTCGAGTGCTCCAAGGCCAAGTTCTCAACAATCGCGACCTGCTGAAGACACCTGCTGAAGACTCCGTCCGGCAAGTCCGGCAACTCCATTGTGAACTTCTTGTGAACTTCCTGGTGAAACCGAT

Full Affymetrix probeset data:

Annotations for 1630071_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720