FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630073_at:

>probe:Drosophila_2:1630073_at:275:219; Interrogation_Position=236; Antisense; AAGTGCCCCAGTATGCGGACTACAA
>probe:Drosophila_2:1630073_at:76:663; Interrogation_Position=256; Antisense; TACAAGGCCCTGTTAAGTGGTCCAC
>probe:Drosophila_2:1630073_at:402:463; Interrogation_Position=303; Antisense; GATTGCAGGCTTTGTGCGCTATTTA
>probe:Drosophila_2:1630073_at:53:455; Interrogation_Position=331; Antisense; GATCAGGATCTGAAGGTCACGCCAA
>probe:Drosophila_2:1630073_at:560:457; Interrogation_Position=375; Antisense; GATTTGGGCGCAGGGCTACGCTAAT
>probe:Drosophila_2:1630073_at:113:375; Interrogation_Position=424; Antisense; GAAGACGTCCCTGCAGCTTTTGAGG
>probe:Drosophila_2:1630073_at:402:95; Interrogation_Position=470; Antisense; AGATTGCAGTCTACTCCAGCGGCAG
>probe:Drosophila_2:1630073_at:288:131; Interrogation_Position=539; Antisense; ACCTGCAGCCGTACTTGAGTGCTTA
>probe:Drosophila_2:1630073_at:169:433; Interrogation_Position=555; Antisense; GAGTGCTTATTTCGACACCCATGTG
>probe:Drosophila_2:1630073_at:261:377; Interrogation_Position=639; Antisense; GAAGCAGATACTCTTTCTCACGGAT
>probe:Drosophila_2:1630073_at:620:459; Interrogation_Position=661; Antisense; GATATTCCAGGAGAAGCGGCCGCCG
>probe:Drosophila_2:1630073_at:364:461; Interrogation_Position=761; Antisense; GATTCGAGTTGATTCCGGACTTTAA
>probe:Drosophila_2:1630073_at:474:541; Interrogation_Position=777; Antisense; GGACTTTAAACCACTTCACAACCTG
>probe:Drosophila_2:1630073_at:623:461; Interrogation_Position=805; Antisense; GTTCCGGTCAATAAATCCCAGGCTT

Paste this into a BLAST search page for me
AAGTGCCCCAGTATGCGGACTACAATACAAGGCCCTGTTAAGTGGTCCACGATTGCAGGCTTTGTGCGCTATTTAGATCAGGATCTGAAGGTCACGCCAAGATTTGGGCGCAGGGCTACGCTAATGAAGACGTCCCTGCAGCTTTTGAGGAGATTGCAGTCTACTCCAGCGGCAGACCTGCAGCCGTACTTGAGTGCTTAGAGTGCTTATTTCGACACCCATGTGGAAGCAGATACTCTTTCTCACGGATGATATTCCAGGAGAAGCGGCCGCCGGATTCGAGTTGATTCCGGACTTTAAGGACTTTAAACCACTTCACAACCTGGTTCCGGTCAATAAATCCCAGGCTT

Full Affymetrix probeset data:

Annotations for 1630073_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720