FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630076_at:

>probe:Drosophila_2:1630076_at:245:369; Interrogation_Position=1421; Antisense; GAAGGCTACCGTCAGTGTTCGATGA
>probe:Drosophila_2:1630076_at:503:513; Interrogation_Position=1435; Antisense; GTGTTCGATGAACTTCCAGCGCAAT
>probe:Drosophila_2:1630076_at:405:435; Interrogation_Position=1466; Antisense; GAGGTCCTCAAAAACGCAATGTCCG
>probe:Drosophila_2:1630076_at:629:501; Interrogation_Position=1486; Antisense; GTCCGACCCGGAGATTCAACAGATC
>probe:Drosophila_2:1630076_at:495:47; Interrogation_Position=1518; Antisense; ATCCGGCTATGCGTATGATCCTCGA
>probe:Drosophila_2:1630076_at:687:173; Interrogation_Position=1551; Antisense; AAAGCGATCCCAATGCGGTCAAAGA
>probe:Drosophila_2:1630076_at:113:369; Interrogation_Position=1585; Antisense; GAATCCTGCCATCGCCGATAAGATA
>probe:Drosophila_2:1630076_at:719:177; Interrogation_Position=1613; Antisense; AAACTGCTGGAGTCGGGCATCATTC
>probe:Drosophila_2:1630076_at:643:11; Interrogation_Position=1634; Antisense; ATTCAGATTCACTAGGCACTCCAGA
>probe:Drosophila_2:1630076_at:118:137; Interrogation_Position=1666; Antisense; ACGAACATCCTCATACAATCACTAA
>probe:Drosophila_2:1630076_at:425:679; Interrogation_Position=1744; Antisense; TATGGCGTCTCTAAGCTGGTTAACC
>probe:Drosophila_2:1630076_at:37:213; Interrogation_Position=1822; Antisense; AAGAAATCACATCGCCTATTCGCAG
>probe:Drosophila_2:1630076_at:56:431; Interrogation_Position=1941; Antisense; GAGTAGGCTCCAAACGTCATGGTCC
>probe:Drosophila_2:1630076_at:285:291; Interrogation_Position=1955; Antisense; CGTCATGGTCCTTATTTTCTTACTA

Paste this into a BLAST search page for me
GAAGGCTACCGTCAGTGTTCGATGAGTGTTCGATGAACTTCCAGCGCAATGAGGTCCTCAAAAACGCAATGTCCGGTCCGACCCGGAGATTCAACAGATCATCCGGCTATGCGTATGATCCTCGAAAAGCGATCCCAATGCGGTCAAAGAGAATCCTGCCATCGCCGATAAGATAAAACTGCTGGAGTCGGGCATCATTCATTCAGATTCACTAGGCACTCCAGAACGAACATCCTCATACAATCACTAATATGGCGTCTCTAAGCTGGTTAACCAAGAAATCACATCGCCTATTCGCAGGAGTAGGCTCCAAACGTCATGGTCCCGTCATGGTCCTTATTTTCTTACTA

Full Affymetrix probeset data:

Annotations for 1630076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720