FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630077_at:

>probe:Drosophila_2:1630077_at:356:447; Interrogation_Position=1015; Antisense; GATGCCTTCTACGATTGCAACTGGA
>probe:Drosophila_2:1630077_at:621:215; Interrogation_Position=1054; Antisense; AAGTTCAAGCGCGAACTGCTCTTCA
>probe:Drosophila_2:1630077_at:600:711; Interrogation_Position=1101; Antisense; TTCTCTTATCTACGCAGGCAACTAC
>probe:Drosophila_2:1630077_at:229:193; Interrogation_Position=1120; Antisense; AACTACATCGCACTCTCGCTGGAGA
>probe:Drosophila_2:1630077_at:553:273; Interrogation_Position=1146; Antisense; CTTCGAGCAGGTCATGAGGTTCACA
>probe:Drosophila_2:1630077_at:327:541; Interrogation_Position=1163; Antisense; GGTTCACATACTCTGTTTTCACACT
>probe:Drosophila_2:1630077_at:342:701; Interrogation_Position=1178; Antisense; TTTTCACACTCTTGCTGAGGGCCAA
>probe:Drosophila_2:1630077_at:11:535; Interrogation_Position=738; Antisense; GGTGTACCAGGAACTCATCGAGTGC
>probe:Drosophila_2:1630077_at:725:535; Interrogation_Position=780; Antisense; GGTCCATCGGCTGAGGGAGATCATT
>probe:Drosophila_2:1630077_at:110:551; Interrogation_Position=795; Antisense; GGAGATCATTCAGCGGGTCCTTTCA
>probe:Drosophila_2:1630077_at:244:53; Interrogation_Position=874; Antisense; ATGCACTTCCTGTACGTAGCGGATG
>probe:Drosophila_2:1630077_at:133:133; Interrogation_Position=910; Antisense; ACCGCCATGATCATCTCGATTGTAT
>probe:Drosophila_2:1630077_at:226:637; Interrogation_Position=925; Antisense; TCGATTGTATTTTTCTCGGCCGTCA
>probe:Drosophila_2:1630077_at:658:129; Interrogation_Position=949; Antisense; ACCTTGGAGGTGTTTGTAATCTGCT

Paste this into a BLAST search page for me
GATGCCTTCTACGATTGCAACTGGAAAGTTCAAGCGCGAACTGCTCTTCATTCTCTTATCTACGCAGGCAACTACAACTACATCGCACTCTCGCTGGAGACTTCGAGCAGGTCATGAGGTTCACAGGTTCACATACTCTGTTTTCACACTTTTTCACACTCTTGCTGAGGGCCAAGGTGTACCAGGAACTCATCGAGTGCGGTCCATCGGCTGAGGGAGATCATTGGAGATCATTCAGCGGGTCCTTTCAATGCACTTCCTGTACGTAGCGGATGACCGCCATGATCATCTCGATTGTATTCGATTGTATTTTTCTCGGCCGTCAACCTTGGAGGTGTTTGTAATCTGCT

Full Affymetrix probeset data:

Annotations for 1630077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720