FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630079_at:

>probe:Drosophila_2:1630079_at:350:25; Interrogation_Position=1768; Antisense; ATAGGCCAACGCAGCTCAGGGAGGA
>probe:Drosophila_2:1630079_at:88:269; Interrogation_Position=1809; Antisense; CAGGCGATGCGCAATCAGCACAAGT
>probe:Drosophila_2:1630079_at:167:113; Interrogation_Position=1825; Antisense; AGCACAAGTCGCTGCCCAAGAAAAA
>probe:Drosophila_2:1630079_at:460:127; Interrogation_Position=1868; Antisense; ACCACTGATTGGAGGCGGCACTTCG
>probe:Drosophila_2:1630079_at:478:497; Interrogation_Position=1892; Antisense; GTCTTACCAGCACGACGAAGGCAGC
>probe:Drosophila_2:1630079_at:547:315; Interrogation_Position=1936; Antisense; GCCTGAGTGCCATCAAGAACCGGTA
>probe:Drosophila_2:1630079_at:441:683; Interrogation_Position=1959; Antisense; TATAAGAAGGGCTCTGGTGCCGGCC
>probe:Drosophila_2:1630079_at:154:575; Interrogation_Position=1985; Antisense; GGCGGAGGTTAAGGCATCTACGATC
>probe:Drosophila_2:1630079_at:671:37; Interrogation_Position=2000; Antisense; ATCTACGATCTACTCGTCGGACGAA
>probe:Drosophila_2:1630079_at:669:149; Interrogation_Position=2038; Antisense; ACTTCGAGGCGCGTCGCAGCAAGAA
>probe:Drosophila_2:1630079_at:602:311; Interrogation_Position=2127; Antisense; GCCAAGAGCGGCCACAGCAACAAGA
>probe:Drosophila_2:1630079_at:244:461; Interrogation_Position=2293; Antisense; GATTAAGCTAGTTCAAGTGCGTTCC
>probe:Drosophila_2:1630079_at:93:87; Interrogation_Position=2308; Antisense; AGTGCGTTCCTTGATTACACCAATA
>probe:Drosophila_2:1630079_at:364:493; Interrogation_Position=2336; Antisense; GTAATTTTCAATTTTCACGCGCTGA

Paste this into a BLAST search page for me
ATAGGCCAACGCAGCTCAGGGAGGACAGGCGATGCGCAATCAGCACAAGTAGCACAAGTCGCTGCCCAAGAAAAAACCACTGATTGGAGGCGGCACTTCGGTCTTACCAGCACGACGAAGGCAGCGCCTGAGTGCCATCAAGAACCGGTATATAAGAAGGGCTCTGGTGCCGGCCGGCGGAGGTTAAGGCATCTACGATCATCTACGATCTACTCGTCGGACGAAACTTCGAGGCGCGTCGCAGCAAGAAGCCAAGAGCGGCCACAGCAACAAGAGATTAAGCTAGTTCAAGTGCGTTCCAGTGCGTTCCTTGATTACACCAATAGTAATTTTCAATTTTCACGCGCTGA

Full Affymetrix probeset data:

Annotations for 1630079_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720