Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630080_at:

>probe:Drosophila_2:1630080_at:722:293; Interrogation_Position=2563; Antisense; CGAGGATCCTCGTCTAGTGTACGTA
>probe:Drosophila_2:1630080_at:498:507; Interrogation_Position=2612; Antisense; GTGCTGCTGGATGGCACGTCCCTAA
>probe:Drosophila_2:1630080_at:710:131; Interrogation_Position=2627; Antisense; ACGTCCCTAACATCCTAACTAGTAG
>probe:Drosophila_2:1630080_at:402:21; Interrogation_Position=2694; Antisense; ATATTAAAGCTCCTTTGGCTCCGGA
>probe:Drosophila_2:1630080_at:75:337; Interrogation_Position=2711; Antisense; GCTCCGGAAGGCATTATTGTACAGT
>probe:Drosophila_2:1630080_at:555:653; Interrogation_Position=2765; Antisense; TAACCTGTAACGAGCGGAGCGGCCG
>probe:Drosophila_2:1630080_at:695:417; Interrogation_Position=2781; Antisense; GAGCGGCCGGACAAGATTGTCACCT
>probe:Drosophila_2:1630080_at:225:335; Interrogation_Position=2823; Antisense; GCTGCCCGCCCTTTAAGTAAGTAGT
>probe:Drosophila_2:1630080_at:570:599; Interrogation_Position=2954; Antisense; TGTACCGTAGGCTAAGTGAGTCCCC
>probe:Drosophila_2:1630080_at:580:491; Interrogation_Position=3000; Antisense; GTAATCCCCGAAGAACTCAGCCAAA
>probe:Drosophila_2:1630080_at:482:145; Interrogation_Position=3014; Antisense; ACTCAGCCAAACTGTCACCTTAAAA
>probe:Drosophila_2:1630080_at:234:183; Interrogation_Position=3036; Antisense; AAAAGCCCCAATTTGATCTGATACT
>probe:Drosophila_2:1630080_at:303:655; Interrogation_Position=3060; Antisense; TAATCGTGTGCGATCTTCGCTCGAA
>probe:Drosophila_2:1630080_at:43:255; Interrogation_Position=3088; Antisense; CAAAACGCGCACTTTCTTTTCTACG

Paste this into a BLAST search page for me
CGAGGATCCTCGTCTAGTGTACGTAGTGCTGCTGGATGGCACGTCCCTAAACGTCCCTAACATCCTAACTAGTAGATATTAAAGCTCCTTTGGCTCCGGAGCTCCGGAAGGCATTATTGTACAGTTAACCTGTAACGAGCGGAGCGGCCGGAGCGGCCGGACAAGATTGTCACCTGCTGCCCGCCCTTTAAGTAAGTAGTTGTACCGTAGGCTAAGTGAGTCCCCGTAATCCCCGAAGAACTCAGCCAAAACTCAGCCAAACTGTCACCTTAAAAAAAAGCCCCAATTTGATCTGATACTTAATCGTGTGCGATCTTCGCTCGAACAAAACGCGCACTTTCTTTTCTACG

Full Affymetrix probeset data:

Annotations for 1630080_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime