Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630083_at:

>probe:Drosophila_2:1630083_at:588:451; Interrogation_Position=1698; Antisense; GATTAGTTTACCTGTCCTTGTTTTG
>probe:Drosophila_2:1630083_at:444:307; Interrogation_Position=1713; Antisense; CCTTGTTTTGCTCATTGCTTGTATG
>probe:Drosophila_2:1630083_at:599:343; Interrogation_Position=1729; Antisense; GCTTGTATGTACTTTCGATCGATTC
>probe:Drosophila_2:1630083_at:321:137; Interrogation_Position=1783; Antisense; ACGACGGAGGAGGTCCAGACGCACA
>probe:Drosophila_2:1630083_at:331:409; Interrogation_Position=1800; Antisense; GACGCACAATGACCCAAAAGTGTAA
>probe:Drosophila_2:1630083_at:524:483; Interrogation_Position=1889; Antisense; GTATCGCACAGATCGAGGGTGCTTA
>probe:Drosophila_2:1630083_at:419:435; Interrogation_Position=1903; Antisense; GAGGGTGCTTATTATATTCTTCTTA
>probe:Drosophila_2:1630083_at:189:653; Interrogation_Position=1926; Antisense; TAATCTTCACACACATTTCATTTGG
>probe:Drosophila_2:1630083_at:279:15; Interrogation_Position=1940; Antisense; ATTTCATTTGGTTAGTTCGTACTCT
>probe:Drosophila_2:1630083_at:669:699; Interrogation_Position=1966; Antisense; TTTATTTTGTTCTTTGCCGCACACC
>probe:Drosophila_2:1630083_at:177:303; Interrogation_Position=1982; Antisense; CCGCACACCACATGACTTTGTCAAT
>probe:Drosophila_2:1630083_at:117:619; Interrogation_Position=2045; Antisense; TGCAGATTTGCGAGATATCACCAAT
>probe:Drosophila_2:1630083_at:19:445; Interrogation_Position=2085; Antisense; GATGAGAATCGATCGGCAGCAATAA
>probe:Drosophila_2:1630083_at:188:703; Interrogation_Position=2114; Antisense; TTATGAACACATACACAGCGCAGTA

Paste this into a BLAST search page for me
GATTAGTTTACCTGTCCTTGTTTTGCCTTGTTTTGCTCATTGCTTGTATGGCTTGTATGTACTTTCGATCGATTCACGACGGAGGAGGTCCAGACGCACAGACGCACAATGACCCAAAAGTGTAAGTATCGCACAGATCGAGGGTGCTTAGAGGGTGCTTATTATATTCTTCTTATAATCTTCACACACATTTCATTTGGATTTCATTTGGTTAGTTCGTACTCTTTTATTTTGTTCTTTGCCGCACACCCCGCACACCACATGACTTTGTCAATTGCAGATTTGCGAGATATCACCAATGATGAGAATCGATCGGCAGCAATAATTATGAACACATACACAGCGCAGTA

Full Affymetrix probeset data:

Annotations for 1630083_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime