FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630084_at:

>probe:Drosophila_2:1630084_at:518:307; Interrogation_Position=437; Antisense; CCAGTGGTGAAGATGCGACGCAGCC
>probe:Drosophila_2:1630084_at:58:533; Interrogation_Position=442; Antisense; GGTGAAGATGCGACGCAGCCAGCCT
>probe:Drosophila_2:1630084_at:633:213; Interrogation_Position=446; Antisense; AAGATGCGACGCAGCCAGCCTTGAA
>probe:Drosophila_2:1630084_at:85:99; Interrogation_Position=447; Antisense; AGATGCGACGCAGCCAGCCTTGAAA
>probe:Drosophila_2:1630084_at:527:51; Interrogation_Position=449; Antisense; ATGCGACGCAGCCAGCCTTGAAATA
>probe:Drosophila_2:1630084_at:659:325; Interrogation_Position=451; Antisense; GCGACGCAGCCAGCCTTGAAATACG
>probe:Drosophila_2:1630084_at:323:411; Interrogation_Position=453; Antisense; GACGCAGCCAGCCTTGAAATACGAA
>probe:Drosophila_2:1630084_at:624:297; Interrogation_Position=455; Antisense; CGCAGCCAGCCTTGAAATACGAACT
>probe:Drosophila_2:1630084_at:418:353; Interrogation_Position=456; Antisense; GCAGCCAGCCTTGAAATACGAACTA
>probe:Drosophila_2:1630084_at:704:261; Interrogation_Position=457; Antisense; CAGCCAGCCTTGAAATACGAACTAA
>probe:Drosophila_2:1630084_at:277:313; Interrogation_Position=459; Antisense; GCCAGCCTTGAAATACGAACTAAAA
>probe:Drosophila_2:1630084_at:727:383; Interrogation_Position=475; Antisense; GAACTAAAAGCCTTTCCCAAGCAGA
>probe:Drosophila_2:1630084_at:543:165; Interrogation_Position=481; Antisense; AAAGCCTTTCCCAAGCAGAAACTCA
>probe:Drosophila_2:1630084_at:657:289; Interrogation_Position=484; Antisense; GCCTTTCCCAAGCAGAAACTCAAGC

Paste this into a BLAST search page for me
CCAGTGGTGAAGATGCGACGCAGCCGGTGAAGATGCGACGCAGCCAGCCTAAGATGCGACGCAGCCAGCCTTGAAAGATGCGACGCAGCCAGCCTTGAAAATGCGACGCAGCCAGCCTTGAAATAGCGACGCAGCCAGCCTTGAAATACGGACGCAGCCAGCCTTGAAATACGAACGCAGCCAGCCTTGAAATACGAACTGCAGCCAGCCTTGAAATACGAACTACAGCCAGCCTTGAAATACGAACTAAGCCAGCCTTGAAATACGAACTAAAAGAACTAAAAGCCTTTCCCAAGCAGAAAAGCCTTTCCCAAGCAGAAACTCAGCCTTTCCCAAGCAGAAACTCAAGC

Full Affymetrix probeset data:

Annotations for 1630084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720