Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630085_s_at:

>probe:Drosophila_2:1630085_s_at:297:87; Interrogation_Position=1014; Antisense; AGTGCGCACTGTAGGCTCCGACTAA
>probe:Drosophila_2:1630085_s_at:477:297; Interrogation_Position=1064; Antisense; CGCACCTTCGCTGCACTGTAAAAAA
>probe:Drosophila_2:1630085_s_at:70:63; Interrogation_Position=1088; Antisense; ATGTCCTAGCCCAGTTAGCTTGTTA
>probe:Drosophila_2:1630085_s_at:117:675; Interrogation_Position=1103; Antisense; TAGCTTGTTAACCTTTTTGCTTTCT
>probe:Drosophila_2:1630085_s_at:545:695; Interrogation_Position=1123; Antisense; TTTCTAACCAACCAACCGTCTGTAT
>probe:Drosophila_2:1630085_s_at:443:483; Interrogation_Position=1144; Antisense; GTATCTTGCTCTTCTTTCTGTATTA
>probe:Drosophila_2:1630085_s_at:392:603; Interrogation_Position=1180; Antisense; TGTTGTTTGGTCTCTTTTGTATATG
>probe:Drosophila_2:1630085_s_at:254:605; Interrogation_Position=698; Antisense; TGATCACTTGCGTGGAGGGCCATCC
>probe:Drosophila_2:1630085_s_at:14:317; Interrogation_Position=725; Antisense; GCCTGATCAGCTGCGGCGAGGACAA
>probe:Drosophila_2:1630085_s_at:636:223; Interrogation_Position=748; Antisense; AAGGTCTTCGACGAGCACACGCTGA
>probe:Drosophila_2:1630085_s_at:194:353; Interrogation_Position=800; Antisense; GCAGCTGTGCCAACTACGGCAAGTA
>probe:Drosophila_2:1630085_s_at:115:451; Interrogation_Position=827; Antisense; GATCGCCGAGCGATCTGTACATGCA
>probe:Drosophila_2:1630085_s_at:63:25; Interrogation_Position=924; Antisense; ATATGTATGTACTTGCTGGCTGCAA
>probe:Drosophila_2:1630085_s_at:482:679; Interrogation_Position=988; Antisense; TAGGTTTACACTGGTTCGCTGCTTC

Paste this into a BLAST search page for me
AGTGCGCACTGTAGGCTCCGACTAACGCACCTTCGCTGCACTGTAAAAAAATGTCCTAGCCCAGTTAGCTTGTTATAGCTTGTTAACCTTTTTGCTTTCTTTTCTAACCAACCAACCGTCTGTATGTATCTTGCTCTTCTTTCTGTATTATGTTGTTTGGTCTCTTTTGTATATGTGATCACTTGCGTGGAGGGCCATCCGCCTGATCAGCTGCGGCGAGGACAAAAGGTCTTCGACGAGCACACGCTGAGCAGCTGTGCCAACTACGGCAAGTAGATCGCCGAGCGATCTGTACATGCAATATGTATGTACTTGCTGGCTGCAATAGGTTTACACTGGTTCGCTGCTTC

Full Affymetrix probeset data:

Annotations for 1630085_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime