FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630086_at:

>probe:Drosophila_2:1630086_at:135:345; Interrogation_Position=1001; Antisense; GCAACTTTACTTTAACCAGCGACCG
>probe:Drosophila_2:1630086_at:163:545; Interrogation_Position=1025; Antisense; GGATCTACATCACCGGCGCAGAGAA
>probe:Drosophila_2:1630086_at:177:137; Interrogation_Position=1049; Antisense; ACGAACGCTTAAGCTTGCGCGTCTA
>probe:Drosophila_2:1630086_at:666:595; Interrogation_Position=1190; Antisense; TGTCCGTTTGGTTTAAGAAGCGCTT
>probe:Drosophila_2:1630086_at:221:205; Interrogation_Position=1207; Antisense; AAGCGCTTCGACAACGTTAGCGACT
>probe:Drosophila_2:1630086_at:294:577; Interrogation_Position=1294; Antisense; GGCGCCCACATACCCAAAGGAAATT
>probe:Drosophila_2:1630086_at:295:357; Interrogation_Position=1367; Antisense; GCAACGGACTTTGTGTGACAGGCCC
>probe:Drosophila_2:1630086_at:595:511; Interrogation_Position=1381; Antisense; GTGACAGGCCCGTTGTGGGCATAAT
>probe:Drosophila_2:1630086_at:98:263; Interrogation_Position=818; Antisense; CAGCACCGGCGGTTCGTTTATTGGT
>probe:Drosophila_2:1630086_at:613:689; Interrogation_Position=836; Antisense; TATTGGTACGCCAGCTGGAGCCGGA
>probe:Drosophila_2:1630086_at:320:135; Interrogation_Position=902; Antisense; ACGCCCTGGGATTGTATCGCCTGGA
>probe:Drosophila_2:1630086_at:299:445; Interrogation_Position=937; Antisense; GATGACACCTGGAGCGTGACGGCCA
>probe:Drosophila_2:1630086_at:238:159; Interrogation_Position=961; Antisense; ACACAACTGGTTTGCGCCGAAGCGG
>probe:Drosophila_2:1630086_at:503:523; Interrogation_Position=984; Antisense; GGGCTCATGGAGCATTAGCAACTTT

Paste this into a BLAST search page for me
GCAACTTTACTTTAACCAGCGACCGGGATCTACATCACCGGCGCAGAGAAACGAACGCTTAAGCTTGCGCGTCTATGTCCGTTTGGTTTAAGAAGCGCTTAAGCGCTTCGACAACGTTAGCGACTGGCGCCCACATACCCAAAGGAAATTGCAACGGACTTTGTGTGACAGGCCCGTGACAGGCCCGTTGTGGGCATAATCAGCACCGGCGGTTCGTTTATTGGTTATTGGTACGCCAGCTGGAGCCGGAACGCCCTGGGATTGTATCGCCTGGAGATGACACCTGGAGCGTGACGGCCAACACAACTGGTTTGCGCCGAAGCGGGGGCTCATGGAGCATTAGCAACTTT

Full Affymetrix probeset data:

Annotations for 1630086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720