FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630087_at:

>probe:Drosophila_2:1630087_at:198:241; Interrogation_Position=588; Antisense; AATAACTGCACGTCGATGGTCCTGG
>probe:Drosophila_2:1630087_at:33:277; Interrogation_Position=650; Antisense; CTTTAACAATTTCCTGCCCAGTGAG
>probe:Drosophila_2:1630087_at:248:281; Interrogation_Position=717; Antisense; CTCACCGTGGACTCAATCAATGCGA
>probe:Drosophila_2:1630087_at:37:235; Interrogation_Position=735; Antisense; AATGCGAACGGATGCTTGCCTGCGT
>probe:Drosophila_2:1630087_at:611:383; Interrogation_Position=776; Antisense; GAACTGCTTTTACATCCTGATGGCG
>probe:Drosophila_2:1630087_at:359:47; Interrogation_Position=789; Antisense; ATCCTGATGGCGTTATGGGTCCTGG
>probe:Drosophila_2:1630087_at:243:575; Interrogation_Position=812; Antisense; GGCCCTTAAGTTTCTGATCGTGCTT
>probe:Drosophila_2:1630087_at:197:451; Interrogation_Position=827; Antisense; GATCGTGCTTTGTTGTATGACCAAG
>probe:Drosophila_2:1630087_at:421:415; Interrogation_Position=845; Antisense; GACCAAGTTCATAGTTCACCGGCAG
>probe:Drosophila_2:1630087_at:371:67; Interrogation_Position=880; Antisense; ATGGCTGCGATAATGTGGGACTCAC
>probe:Drosophila_2:1630087_at:635:149; Interrogation_Position=917; Antisense; ACATCCCTTGGTCGTGGTGAAATAT
>probe:Drosophila_2:1630087_at:69:395; Interrogation_Position=935; Antisense; GAAATATCCGTGTAACGTGCGCTGT
>probe:Drosophila_2:1630087_at:57:141; Interrogation_Position=949; Antisense; ACGTGCGCTGTGTAACAATTGCCGA
>probe:Drosophila_2:1630087_at:208:471; Interrogation_Position=984; Antisense; GTATCCGACAACGTTCCCGATATTA

Paste this into a BLAST search page for me
AATAACTGCACGTCGATGGTCCTGGCTTTAACAATTTCCTGCCCAGTGAGCTCACCGTGGACTCAATCAATGCGAAATGCGAACGGATGCTTGCCTGCGTGAACTGCTTTTACATCCTGATGGCGATCCTGATGGCGTTATGGGTCCTGGGGCCCTTAAGTTTCTGATCGTGCTTGATCGTGCTTTGTTGTATGACCAAGGACCAAGTTCATAGTTCACCGGCAGATGGCTGCGATAATGTGGGACTCACACATCCCTTGGTCGTGGTGAAATATGAAATATCCGTGTAACGTGCGCTGTACGTGCGCTGTGTAACAATTGCCGAGTATCCGACAACGTTCCCGATATTA

Full Affymetrix probeset data:

Annotations for 1630087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720