FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630088_at:

>probe:Drosophila_2:1630088_at:416:377; Interrogation_Position=195; Antisense; GAAGCACAAGCACTCCAAGACGGAG
>probe:Drosophila_2:1630088_at:551:245; Interrogation_Position=229; Antisense; AATTATCCTGCATATCCTAATCCGG
>probe:Drosophila_2:1630088_at:354:525; Interrogation_Position=252; Antisense; GGGCTATCCTCCGTATCAAGAAATG
>probe:Drosophila_2:1630088_at:124:395; Interrogation_Position=271; Antisense; GAAATGGGAGGCTATCCTTCATATC
>probe:Drosophila_2:1630088_at:156:23; Interrogation_Position=291; Antisense; ATATCTCTACAATCCGTACATGCCG
>probe:Drosophila_2:1630088_at:362:479; Interrogation_Position=315; Antisense; GTATCCTCCGTATCCTCAAATGGGA
>probe:Drosophila_2:1630088_at:71:257; Interrogation_Position=331; Antisense; CAAATGGGAGGCTATCCTTCATATC
>probe:Drosophila_2:1630088_at:529:21; Interrogation_Position=351; Antisense; ATATCCCTACAATCTGTACATGCCC
>probe:Drosophila_2:1630088_at:348:523; Interrogation_Position=473; Antisense; GGGCTCCCGGACAGAATCCAGTTAA
>probe:Drosophila_2:1630088_at:697:573; Interrogation_Position=583; Antisense; GGCGGCTCGAGCGTTATTAATCATT
>probe:Drosophila_2:1630088_at:339:241; Interrogation_Position=626; Antisense; AATACAACGAGGACGGTCACCACCA
>probe:Drosophila_2:1630088_at:330:239; Interrogation_Position=650; Antisense; AATCTTCAACGTAGTCGCAGTCGAG
>probe:Drosophila_2:1630088_at:290:663; Interrogation_Position=696; Antisense; TAAACGTCGGATTGGGCCTCAAGTT
>probe:Drosophila_2:1630088_at:624:269; Interrogation_Position=713; Antisense; CTCAAGTTTCAAGTCGGCCTTCAAT

Paste this into a BLAST search page for me
GAAGCACAAGCACTCCAAGACGGAGAATTATCCTGCATATCCTAATCCGGGGGCTATCCTCCGTATCAAGAAATGGAAATGGGAGGCTATCCTTCATATCATATCTCTACAATCCGTACATGCCGGTATCCTCCGTATCCTCAAATGGGACAAATGGGAGGCTATCCTTCATATCATATCCCTACAATCTGTACATGCCCGGGCTCCCGGACAGAATCCAGTTAAGGCGGCTCGAGCGTTATTAATCATTAATACAACGAGGACGGTCACCACCAAATCTTCAACGTAGTCGCAGTCGAGTAAACGTCGGATTGGGCCTCAAGTTCTCAAGTTTCAAGTCGGCCTTCAAT

Full Affymetrix probeset data:

Annotations for 1630088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720