FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630089_at:

>probe:Drosophila_2:1630089_at:650:483; Interrogation_Position=1812; Antisense; GTAGCTTGGGCACCGTTTTACTGAG
>probe:Drosophila_2:1630089_at:537:43; Interrogation_Position=1847; Antisense; ATCCGTTCGTTCAACTGGCCAATTG
>probe:Drosophila_2:1630089_at:635:721; Interrogation_Position=1869; Antisense; TTGTATTGATCCTTGGTGGGCTCGT
>probe:Drosophila_2:1630089_at:723:291; Interrogation_Position=1891; Antisense; CGTCGGATCCTTTTACATCTACGAG
>probe:Drosophila_2:1630089_at:188:667; Interrogation_Position=1904; Antisense; TACATCTACGAGTACGCCGCTTGGA
>probe:Drosophila_2:1630089_at:109:375; Interrogation_Position=1947; Antisense; GAAGTTTCAAGAGCCAGTACGCCAG
>probe:Drosophila_2:1630089_at:29:91; Interrogation_Position=1962; Antisense; AGTACGCCAGGCTCTTGCAACAACG
>probe:Drosophila_2:1630089_at:549:615; Interrogation_Position=1977; Antisense; TGCAACAACGTCTGCGGTCGGATGT
>probe:Drosophila_2:1630089_at:261:703; Interrogation_Position=2020; Antisense; TTTTGAGCTCCAGTTGCGACAGCAC
>probe:Drosophila_2:1630089_at:157:527; Interrogation_Position=2067; Antisense; GGGAAGCCCAGTCCAATGAGACACT
>probe:Drosophila_2:1630089_at:597:657; Interrogation_Position=2106; Antisense; TAAGGACCGCGGAGCTGACCAAACA
>probe:Drosophila_2:1630089_at:298:81; Interrogation_Position=2145; Antisense; AGGTGTTGCAGCTCAGCCTGAAGAA
>probe:Drosophila_2:1630089_at:467:91; Interrogation_Position=2169; Antisense; AGTTTCGGGACAAGGGACAGCTGCT
>probe:Drosophila_2:1630089_at:27:135; Interrogation_Position=2383; Antisense; ACGATTGGTCTTCACTACTTTAAAG

Paste this into a BLAST search page for me
GTAGCTTGGGCACCGTTTTACTGAGATCCGTTCGTTCAACTGGCCAATTGTTGTATTGATCCTTGGTGGGCTCGTCGTCGGATCCTTTTACATCTACGAGTACATCTACGAGTACGCCGCTTGGAGAAGTTTCAAGAGCCAGTACGCCAGAGTACGCCAGGCTCTTGCAACAACGTGCAACAACGTCTGCGGTCGGATGTTTTTGAGCTCCAGTTGCGACAGCACGGGAAGCCCAGTCCAATGAGACACTTAAGGACCGCGGAGCTGACCAAACAAGGTGTTGCAGCTCAGCCTGAAGAAAGTTTCGGGACAAGGGACAGCTGCTACGATTGGTCTTCACTACTTTAAAG

Full Affymetrix probeset data:

Annotations for 1630089_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720