FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630090_at:

>probe:Drosophila_2:1630090_at:161:599; Interrogation_Position=1448; Antisense; TCTTTAAATACGAGCCCGGGCTGAT
>probe:Drosophila_2:1630090_at:56:461; Interrogation_Position=1470; Antisense; GATTGTGGAGTGCTCCCTGCTAAAA
>probe:Drosophila_2:1630090_at:641:301; Interrogation_Position=1484; Antisense; CCCTGCTAAAACCATGCACCAATGT
>probe:Drosophila_2:1630090_at:349:335; Interrogation_Position=1522; Antisense; GCTGAAATGCGCCAATATCCGGATA
>probe:Drosophila_2:1630090_at:94:411; Interrogation_Position=1573; Antisense; GACCAAGTGGCCCTACTACGTTTGG
>probe:Drosophila_2:1630090_at:118:439; Interrogation_Position=1615; Antisense; GAGGAACTGCTACGCCAGGTCAACT
>probe:Drosophila_2:1630090_at:592:79; Interrogation_Position=1631; Antisense; AGGTCAACTGCTCCGAGAGGCAGCT
>probe:Drosophila_2:1630090_at:225:439; Interrogation_Position=1647; Antisense; GAGGCAGCTGAAAGTGCTCTCTGGC
>probe:Drosophila_2:1630090_at:394:267; Interrogation_Position=1675; Antisense; CAGGAGACGCTCTATTGGCGAAAAA
>probe:Drosophila_2:1630090_at:574:545; Interrogation_Position=1707; Antisense; GGATCGCGAGGCGAAACTCTCGAAA
>probe:Drosophila_2:1630090_at:192:191; Interrogation_Position=1721; Antisense; AACTCTCGAAAAAGGTGCGCGTGCA
>probe:Drosophila_2:1630090_at:587:333; Interrogation_Position=1779; Antisense; GCTGGGCAAGCACATTAAGTTTGAT
>probe:Drosophila_2:1630090_at:132:59; Interrogation_Position=1811; Antisense; ATGATGAAGTGCAGGCGGCCGCCAT
>probe:Drosophila_2:1630090_at:609:319; Interrogation_Position=1828; Antisense; GCCGCCATGGACTGAGTCACTTTCA

Paste this into a BLAST search page for me
TCTTTAAATACGAGCCCGGGCTGATGATTGTGGAGTGCTCCCTGCTAAAACCCTGCTAAAACCATGCACCAATGTGCTGAAATGCGCCAATATCCGGATAGACCAAGTGGCCCTACTACGTTTGGGAGGAACTGCTACGCCAGGTCAACTAGGTCAACTGCTCCGAGAGGCAGCTGAGGCAGCTGAAAGTGCTCTCTGGCCAGGAGACGCTCTATTGGCGAAAAAGGATCGCGAGGCGAAACTCTCGAAAAACTCTCGAAAAAGGTGCGCGTGCAGCTGGGCAAGCACATTAAGTTTGATATGATGAAGTGCAGGCGGCCGCCATGCCGCCATGGACTGAGTCACTTTCA

Full Affymetrix probeset data:

Annotations for 1630090_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720