FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630091_at:

>probe:Drosophila_2:1630091_at:431:135; Interrogation_Position=276; Antisense; ACGAATGTCCCGATTGAGTTACTCA
>probe:Drosophila_2:1630091_at:294:381; Interrogation_Position=304; Antisense; GAACTGGAGGACTTAGCCCGACTGG
>probe:Drosophila_2:1630091_at:94:137; Interrogation_Position=346; Antisense; ACGCACAAGTTTTGCCTGAACTCAC
>probe:Drosophila_2:1630091_at:472:545; Interrogation_Position=372; Antisense; GGAGTTCTATTACGTGGGTACCAAT
>probe:Drosophila_2:1630091_at:330:19; Interrogation_Position=395; Antisense; ATATAGGTTCCACCCACTATTTGGG
>probe:Drosophila_2:1630091_at:680:73; Interrogation_Position=437; Antisense; AGGACCTAGAACTCATGTTGCGGAT
>probe:Drosophila_2:1630091_at:148:65; Interrogation_Position=505; Antisense; ATGGGTGTCTATATGCCGACAACTT
>probe:Drosophila_2:1630091_at:235:175; Interrogation_Position=550; Antisense; AAAGCCCTACTACTGATGGCAGATC
>probe:Drosophila_2:1630091_at:419:593; Interrogation_Position=587; Antisense; TGGGCTGTTCGGCTATGAGATTCAC
>probe:Drosophila_2:1630091_at:504:103; Interrogation_Position=697; Antisense; AGACCAGGAGCTGCTTGCAAGCGCT
>probe:Drosophila_2:1630091_at:288:729; Interrogation_Position=721; Antisense; TTGGATCCCACATACTCAGCACTTT
>probe:Drosophila_2:1630091_at:314:113; Interrogation_Position=738; Antisense; AGCACTTTGTGCTGTTGGTGAAAAC
>probe:Drosophila_2:1630091_at:485:481; Interrogation_Position=796; Antisense; GTATTCCAGTTACCCCTCGATTTAT
>probe:Drosophila_2:1630091_at:447:501; Interrogation_Position=827; Antisense; GTCGACAAGCTTATGTGCCAGCCAT

Paste this into a BLAST search page for me
ACGAATGTCCCGATTGAGTTACTCAGAACTGGAGGACTTAGCCCGACTGGACGCACAAGTTTTGCCTGAACTCACGGAGTTCTATTACGTGGGTACCAATATATAGGTTCCACCCACTATTTGGGAGGACCTAGAACTCATGTTGCGGATATGGGTGTCTATATGCCGACAACTTAAAGCCCTACTACTGATGGCAGATCTGGGCTGTTCGGCTATGAGATTCACAGACCAGGAGCTGCTTGCAAGCGCTTTGGATCCCACATACTCAGCACTTTAGCACTTTGTGCTGTTGGTGAAAACGTATTCCAGTTACCCCTCGATTTATGTCGACAAGCTTATGTGCCAGCCAT

Full Affymetrix probeset data:

Annotations for 1630091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720