Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630092_at:

>probe:Drosophila_2:1630092_at:523:561; Interrogation_Position=1002; Antisense; GGAACTCTATAGGTCACTGCCATCT
>probe:Drosophila_2:1630092_at:423:145; Interrogation_Position=1017; Antisense; ACTGCCATCTTCTTAGGATTCTTAA
>probe:Drosophila_2:1630092_at:406:543; Interrogation_Position=1032; Antisense; GGATTCTTAACCTATCGTCTACCAA
>probe:Drosophila_2:1630092_at:676:673; Interrogation_Position=1051; Antisense; TACCAAGCTGGTGGACCTCCGAAGC
>probe:Drosophila_2:1630092_at:291:205; Interrogation_Position=1072; Antisense; AAGCTCCTGCCTGACAAAAGTTCTG
>probe:Drosophila_2:1630092_at:557:617; Interrogation_Position=1095; Antisense; TGCTAAGTCGCAGGATTCCACTGAC
>probe:Drosophila_2:1630092_at:7:543; Interrogation_Position=1165; Antisense; GGATTTTGATAGTGCCTCCTTGAAA
>probe:Drosophila_2:1630092_at:421:613; Interrogation_Position=1185; Antisense; TGAAAATCTCCTTTGAGCCGATCCA
>probe:Drosophila_2:1630092_at:407:393; Interrogation_Position=1238; Antisense; GAAATCGAATTCAGTCCAGACTCGT
>probe:Drosophila_2:1630092_at:643:231; Interrogation_Position=1285; Antisense; AATGACATTTCTACCTCAATCCGTC
>probe:Drosophila_2:1630092_at:77:491; Interrogation_Position=1358; Antisense; GTAAAATGTTGTACCCTTTGCAAGG
>probe:Drosophila_2:1630092_at:393:163; Interrogation_Position=1414; Antisense; AAATCTTTTATCTGTCTACCTACCA
>probe:Drosophila_2:1630092_at:169:587; Interrogation_Position=948; Antisense; TGGAGGAGCTACACCTTTTGGCGAT
>probe:Drosophila_2:1630092_at:61:691; Interrogation_Position=964; Antisense; TTTGGCGATGCGAGAAGTTCCGTCT

Paste this into a BLAST search page for me
GGAACTCTATAGGTCACTGCCATCTACTGCCATCTTCTTAGGATTCTTAAGGATTCTTAACCTATCGTCTACCAATACCAAGCTGGTGGACCTCCGAAGCAAGCTCCTGCCTGACAAAAGTTCTGTGCTAAGTCGCAGGATTCCACTGACGGATTTTGATAGTGCCTCCTTGAAATGAAAATCTCCTTTGAGCCGATCCAGAAATCGAATTCAGTCCAGACTCGTAATGACATTTCTACCTCAATCCGTCGTAAAATGTTGTACCCTTTGCAAGGAAATCTTTTATCTGTCTACCTACCATGGAGGAGCTACACCTTTTGGCGATTTTGGCGATGCGAGAAGTTCCGTCT

Full Affymetrix probeset data:

Annotations for 1630092_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime