FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630093_at:

>probe:Drosophila_2:1630093_at:395:189; Interrogation_Position=152; Antisense; AACAGATGGTCTGCGATGTCCTCCA
>probe:Drosophila_2:1630093_at:485:133; Interrogation_Position=176; Antisense; ACCCAGGATTGTCGTCGGTGAACAA
>probe:Drosophila_2:1630093_at:453:511; Interrogation_Position=193; Antisense; GTGAACAAGACCGAGATCCGCGAGA
>probe:Drosophila_2:1630093_at:120:379; Interrogation_Position=216; Antisense; GAAGCTCGCCGCCATGTACAAGGTC
>probe:Drosophila_2:1630093_at:29:253; Interrogation_Position=336; Antisense; CAAGAAGTTCGAGCCCAAGTACCGC
>probe:Drosophila_2:1630093_at:173:495; Interrogation_Position=368; Antisense; GTCACGGCCTCTTCGAACAGAAGAA
>probe:Drosophila_2:1630093_at:394:113; Interrogation_Position=392; Antisense; AGCAGACCCGCAAGCAGCGCAAGGA
>probe:Drosophila_2:1630093_at:587:223; Interrogation_Position=436; Antisense; AAGGTGCGCGGTACTGCCAAGGCCA
>probe:Drosophila_2:1630093_at:182:559; Interrogation_Position=494; Antisense; GGAAAGCTCGTCTGCGGGCATCGCC
>probe:Drosophila_2:1630093_at:97:315; Interrogation_Position=516; Antisense; GCCTGCTATTCCCAAAAGCTGCTGG
>probe:Drosophila_2:1630093_at:357:207; Interrogation_Position=531; Antisense; AAGCTGCTGGTTATGCGTTAGTCAA
>probe:Drosophila_2:1630093_at:325:701; Interrogation_Position=558; Antisense; TTCTTTACCAACCAATCAACAACCG
>probe:Drosophila_2:1630093_at:653:721; Interrogation_Position=607; Antisense; TTGGAGCGGCTTTTGTTTGTAAACT
>probe:Drosophila_2:1630093_at:455:205; Interrogation_Position=75; Antisense; AAGCTCCGTCAAAATGTCCGGTACA

Paste this into a BLAST search page for me
AACAGATGGTCTGCGATGTCCTCCAACCCAGGATTGTCGTCGGTGAACAAGTGAACAAGACCGAGATCCGCGAGAGAAGCTCGCCGCCATGTACAAGGTCCAAGAAGTTCGAGCCCAAGTACCGCGTCACGGCCTCTTCGAACAGAAGAAAGCAGACCCGCAAGCAGCGCAAGGAAAGGTGCGCGGTACTGCCAAGGCCAGGAAAGCTCGTCTGCGGGCATCGCCGCCTGCTATTCCCAAAAGCTGCTGGAAGCTGCTGGTTATGCGTTAGTCAATTCTTTACCAACCAATCAACAACCGTTGGAGCGGCTTTTGTTTGTAAACTAAGCTCCGTCAAAATGTCCGGTACA

Full Affymetrix probeset data:

Annotations for 1630093_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720