Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630094_at:

>probe:Drosophila_2:1630094_at:343:243; Interrogation_Position=2493; Antisense; AATTTATATTTTGTAAGGCGAGCCA
>probe:Drosophila_2:1630094_at:242:453; Interrogation_Position=2562; Antisense; GATCAGATCAGGTTAATGAGCCGCA
>probe:Drosophila_2:1630094_at:261:231; Interrogation_Position=2576; Antisense; AATGAGCCGCAGACTGGGACAGATA
>probe:Drosophila_2:1630094_at:134:423; Interrogation_Position=2616; Antisense; GAGAGCCAAATCACTAATTATACGA
>probe:Drosophila_2:1630094_at:663:25; Interrogation_Position=2635; Antisense; ATACGAGAACCGAGTTAGTCTGAGA
>probe:Drosophila_2:1630094_at:259:423; Interrogation_Position=2663; Antisense; GAGAAATCGTGGCACATCATCCGAA
>probe:Drosophila_2:1630094_at:459:567; Interrogation_Position=2673; Antisense; GGCACATCATCCGAAGCATCACAGG
>probe:Drosophila_2:1630094_at:410:459; Interrogation_Position=2697; Antisense; GATATTCAGGATATTCCGGGCAGCA
>probe:Drosophila_2:1630094_at:194:177; Interrogation_Position=2760; Antisense; AAACGGCTTCCATAGTTAATGTTAT
>probe:Drosophila_2:1630094_at:268:345; Interrogation_Position=2793; Antisense; GCATAAATACACCACTCTAAACTAA
>probe:Drosophila_2:1630094_at:598:159; Interrogation_Position=2818; Antisense; ACAACAAAAGCTTGCACACGCCCTT
>probe:Drosophila_2:1630094_at:514:133; Interrogation_Position=2855; Antisense; ACCCTTATCCACTTGTTCTTTTGAT
>probe:Drosophila_2:1630094_at:713:147; Interrogation_Position=2865; Antisense; ACTTGTTCTTTTGATCGTATTGTAC
>probe:Drosophila_2:1630094_at:100:29; Interrogation_Position=2939; Antisense; ATACGTGTATGCGATGTTGTTAATT

Paste this into a BLAST search page for me
AATTTATATTTTGTAAGGCGAGCCAGATCAGATCAGGTTAATGAGCCGCAAATGAGCCGCAGACTGGGACAGATAGAGAGCCAAATCACTAATTATACGAATACGAGAACCGAGTTAGTCTGAGAGAGAAATCGTGGCACATCATCCGAAGGCACATCATCCGAAGCATCACAGGGATATTCAGGATATTCCGGGCAGCAAAACGGCTTCCATAGTTAATGTTATGCATAAATACACCACTCTAAACTAAACAACAAAAGCTTGCACACGCCCTTACCCTTATCCACTTGTTCTTTTGATACTTGTTCTTTTGATCGTATTGTACATACGTGTATGCGATGTTGTTAATT

Full Affymetrix probeset data:

Annotations for 1630094_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime