FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630096_at:

>probe:Drosophila_2:1630096_at:676:563; Interrogation_Position=246; Antisense; GGAATCGTCCGGCATTGTGACCGTA
>probe:Drosophila_2:1630096_at:601:3; Interrogation_Position=259; Antisense; ATTGTGACCGTACTGGTTCTCTACC
>probe:Drosophila_2:1630096_at:479:383; Interrogation_Position=364; Antisense; GAACTGATGGCCATGGAGCGCCGCC
>probe:Drosophila_2:1630096_at:488:529; Interrogation_Position=424; Antisense; GGGTTAACTCTGCTGCCAAACTGGA
>probe:Drosophila_2:1630096_at:648:703; Interrogation_Position=467; Antisense; TTATTCGCGAAGTGGCTGCTCCTAG
>probe:Drosophila_2:1630096_at:166:279; Interrogation_Position=488; Antisense; CTAGGCCTTCAGTCATTCAACTGGA
>probe:Drosophila_2:1630096_at:411:213; Interrogation_Position=512; Antisense; AAGAGCAGCGCTTGCGGATGCGTCT
>probe:Drosophila_2:1630096_at:698:445; Interrogation_Position=528; Antisense; GATGCGTCTGCTCCAGCTAACGGAT
>probe:Drosophila_2:1630096_at:474:355; Interrogation_Position=570; Antisense; GCACGATTCCCAGGATTGGCACGAT
>probe:Drosophila_2:1630096_at:679:727; Interrogation_Position=585; Antisense; TTGGCACGATGCTGTGGATGCGCCA
>probe:Drosophila_2:1630096_at:556:127; Interrogation_Position=668; Antisense; ACCTTCCCTTAGACTCCGAATGAAT
>probe:Drosophila_2:1630096_at:475:53; Interrogation_Position=687; Antisense; ATGAATCTCATTCACCCGAGGAACT
>probe:Drosophila_2:1630096_at:655:675; Interrogation_Position=723; Antisense; TAGCGTAACACACTCAAACCTGCAG
>probe:Drosophila_2:1630096_at:366:175; Interrogation_Position=738; Antisense; AAACCTGCAGCATGAGTTCACAAAT

Paste this into a BLAST search page for me
GGAATCGTCCGGCATTGTGACCGTAATTGTGACCGTACTGGTTCTCTACCGAACTGATGGCCATGGAGCGCCGCCGGGTTAACTCTGCTGCCAAACTGGATTATTCGCGAAGTGGCTGCTCCTAGCTAGGCCTTCAGTCATTCAACTGGAAAGAGCAGCGCTTGCGGATGCGTCTGATGCGTCTGCTCCAGCTAACGGATGCACGATTCCCAGGATTGGCACGATTTGGCACGATGCTGTGGATGCGCCAACCTTCCCTTAGACTCCGAATGAATATGAATCTCATTCACCCGAGGAACTTAGCGTAACACACTCAAACCTGCAGAAACCTGCAGCATGAGTTCACAAAT

Full Affymetrix probeset data:

Annotations for 1630096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720