Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630098_a_at:

>probe:Drosophila_2:1630098_a_at:128:371; Interrogation_Position=1006; Antisense; GAAGGCGTTGACTGTTCTTGTTAAA
>probe:Drosophila_2:1630098_a_at:320:575; Interrogation_Position=1009; Antisense; GGCGTTGACTGTTCTTGTTAAATCT
>probe:Drosophila_2:1630098_a_at:483:405; Interrogation_Position=1015; Antisense; GACTGTTCTTGTTAAATCTTATTGT
>probe:Drosophila_2:1630098_a_at:573:163; Interrogation_Position=1028; Antisense; AAATCTTATTGTTGAAATCTATTGA
>probe:Drosophila_2:1630098_a_at:605:77; Interrogation_Position=849; Antisense; AGGATCCTCTCAGGCCCACAACGGT
>probe:Drosophila_2:1630098_a_at:284:159; Interrogation_Position=866; Antisense; ACAACGGTGGTGTGGCACCCGCCCT
>probe:Drosophila_2:1630098_a_at:384:107; Interrogation_Position=917; Antisense; AGAAGGCTAATGCTCAGATCCCTGA
>probe:Drosophila_2:1630098_a_at:13:657; Interrogation_Position=924; Antisense; TAATGCTCAGATCCCTGAGAACGCT
>probe:Drosophila_2:1630098_a_at:676:279; Interrogation_Position=929; Antisense; CTCAGATCCCTGAGAACGCTTACCT
>probe:Drosophila_2:1630098_a_at:241:719; Interrogation_Position=960; Antisense; TTCCATCTTCCGTCGTCGTTTGTAA
>probe:Drosophila_2:1630098_a_at:578:271; Interrogation_Position=963; Antisense; CATCTTCCGTCGTCGTTTGTAAATA
>probe:Drosophila_2:1630098_a_at:290:643; Interrogation_Position=965; Antisense; TCTTCCGTCGTCGTTTGTAAATATT
>probe:Drosophila_2:1630098_a_at:76:491; Interrogation_Position=981; Antisense; GTAAATATTTTAACGACTTCGAGAT
>probe:Drosophila_2:1630098_a_at:459:275; Interrogation_Position=997; Antisense; CTTCGAGATGAAGGCGTTGACTGTT

Paste this into a BLAST search page for me
GAAGGCGTTGACTGTTCTTGTTAAAGGCGTTGACTGTTCTTGTTAAATCTGACTGTTCTTGTTAAATCTTATTGTAAATCTTATTGTTGAAATCTATTGAAGGATCCTCTCAGGCCCACAACGGTACAACGGTGGTGTGGCACCCGCCCTAGAAGGCTAATGCTCAGATCCCTGATAATGCTCAGATCCCTGAGAACGCTCTCAGATCCCTGAGAACGCTTACCTTTCCATCTTCCGTCGTCGTTTGTAACATCTTCCGTCGTCGTTTGTAAATATCTTCCGTCGTCGTTTGTAAATATTGTAAATATTTTAACGACTTCGAGATCTTCGAGATGAAGGCGTTGACTGTT

Full Affymetrix probeset data:

Annotations for 1630098_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime