Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630099_at:

>probe:Drosophila_2:1630099_at:11:263; Interrogation_Position=2877; Antisense; CATGGAAGACCGTCCGGACGTGGAC
>probe:Drosophila_2:1630099_at:113:557; Interrogation_Position=2892; Antisense; GGACGTGGACATGGACTCTCTGGAC
>probe:Drosophila_2:1630099_at:318:145; Interrogation_Position=2906; Antisense; ACTCTCTGGACGGATTGATGGGTGT
>probe:Drosophila_2:1630099_at:198:497; Interrogation_Position=3007; Antisense; GTCATTGAGGCGACCATCATGTGCA
>probe:Drosophila_2:1630099_at:302:647; Interrogation_Position=3023; Antisense; TCATGTGCATGATATCGCGGATTGT
>probe:Drosophila_2:1630099_at:137:395; Interrogation_Position=3103; Antisense; GAAATGGGCGAAAGTCTGACACAGA
>probe:Drosophila_2:1630099_at:105:259; Interrogation_Position=3122; Antisense; CACAGATCATCGCTTTTGCCAAGGA
>probe:Drosophila_2:1630099_at:62:111; Interrogation_Position=3149; Antisense; AGCAAGAAACCTCTCAGATAGACGA
>probe:Drosophila_2:1630099_at:715:455; Interrogation_Position=3165; Antisense; GATAGACGAGTCCAAGCCTTCTTCT
>probe:Drosophila_2:1630099_at:199:309; Interrogation_Position=3176; Antisense; CCAAGCCTTCTTCTTAGGCATGCAA
>probe:Drosophila_2:1630099_at:472:429; Interrogation_Position=3236; Antisense; GAGTTCTTGACCTTTTCTCAATCAT
>probe:Drosophila_2:1630099_at:706:567; Interrogation_Position=3369; Antisense; GGCTATTTTAATTTTTGGCCGAGCA
>probe:Drosophila_2:1630099_at:140:579; Interrogation_Position=3385; Antisense; GGCCGAGCATTGTAATTGTGTTGTA
>probe:Drosophila_2:1630099_at:182:591; Interrogation_Position=3401; Antisense; TGTGTTGTAAACTTTTCCCTTGGAT

Paste this into a BLAST search page for me
CATGGAAGACCGTCCGGACGTGGACGGACGTGGACATGGACTCTCTGGACACTCTCTGGACGGATTGATGGGTGTGTCATTGAGGCGACCATCATGTGCATCATGTGCATGATATCGCGGATTGTGAAATGGGCGAAAGTCTGACACAGACACAGATCATCGCTTTTGCCAAGGAAGCAAGAAACCTCTCAGATAGACGAGATAGACGAGTCCAAGCCTTCTTCTCCAAGCCTTCTTCTTAGGCATGCAAGAGTTCTTGACCTTTTCTCAATCATGGCTATTTTAATTTTTGGCCGAGCAGGCCGAGCATTGTAATTGTGTTGTATGTGTTGTAAACTTTTCCCTTGGAT

Full Affymetrix probeset data:

Annotations for 1630099_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime