FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630102_at:

>probe:Drosophila_2:1630102_at:662:497; Interrogation_Position=169; Antisense; GTCGGAACTATATTCCCATGGCCGG
>probe:Drosophila_2:1630102_at:366:19; Interrogation_Position=203; Antisense; ATTTCCGATGAGTTCAGCGCAGCGT
>probe:Drosophila_2:1630102_at:594:121; Interrogation_Position=223; Antisense; AGCGTTTGATCTTTGGTTGCGGTTC
>probe:Drosophila_2:1630102_at:713:329; Interrogation_Position=241; Antisense; GCGGTTCCTTGGTTGTCATGATGAT
>probe:Drosophila_2:1630102_at:463:647; Interrogation_Position=256; Antisense; TCATGATGATCATTCCCTTCTACTG
>probe:Drosophila_2:1630102_at:707:435; Interrogation_Position=305; Antisense; GAGGATGCATTTGGGACTTCCGCCG
>probe:Drosophila_2:1630102_at:665:603; Interrogation_Position=398; Antisense; TGATCTTACGACACGCTTTCCTTTA
>probe:Drosophila_2:1630102_at:48:327; Interrogation_Position=412; Antisense; GCTTTCCTTTAAACGGTGACTTCTG
>probe:Drosophila_2:1630102_at:60:403; Interrogation_Position=429; Antisense; GACTTCTGAATAACACTTTCCTGGG
>probe:Drosophila_2:1630102_at:232:211; Interrogation_Position=465; Antisense; AAGAACTTGCAACTGCGTGGCGCTA
>probe:Drosophila_2:1630102_at:338:623; Interrogation_Position=478; Antisense; TGCGTGGCGCTATTTCTATCAACAA
>probe:Drosophila_2:1630102_at:404:661; Interrogation_Position=513; Antisense; TAAAATTGCGCCATATCGATCGTTA
>probe:Drosophila_2:1630102_at:534:701; Interrogation_Position=61; Antisense; TTATTTTGATCCACACAGGCGTTAA
>probe:Drosophila_2:1630102_at:704:267; Interrogation_Position=76; Antisense; CAGGCGTTAACATCTTTGGGAGCAA

Paste this into a BLAST search page for me
GTCGGAACTATATTCCCATGGCCGGATTTCCGATGAGTTCAGCGCAGCGTAGCGTTTGATCTTTGGTTGCGGTTCGCGGTTCCTTGGTTGTCATGATGATTCATGATGATCATTCCCTTCTACTGGAGGATGCATTTGGGACTTCCGCCGTGATCTTACGACACGCTTTCCTTTAGCTTTCCTTTAAACGGTGACTTCTGGACTTCTGAATAACACTTTCCTGGGAAGAACTTGCAACTGCGTGGCGCTATGCGTGGCGCTATTTCTATCAACAATAAAATTGCGCCATATCGATCGTTATTATTTTGATCCACACAGGCGTTAACAGGCGTTAACATCTTTGGGAGCAA

Full Affymetrix probeset data:

Annotations for 1630102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720