FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630103_at:

>probe:Drosophila_2:1630103_at:112:215; Interrogation_Position=244; Antisense; AAGATGGGCATATCCACGCGCGAAG
>probe:Drosophila_2:1630103_at:170:595; Interrogation_Position=248; Antisense; TGGGCATATCCACGCGCGAAGTCAG
>probe:Drosophila_2:1630103_at:235:323; Interrogation_Position=263; Antisense; GCGAAGTCAGTCTCCCGAAGCCGGG
>probe:Drosophila_2:1630103_at:518:375; Interrogation_Position=279; Antisense; GAAGCCGGGACAAAGACCTCGACCG
>probe:Drosophila_2:1630103_at:257:525; Interrogation_Position=285; Antisense; GGGACAAAGACCTCGACCGCACGAC
>probe:Drosophila_2:1630103_at:84:413; Interrogation_Position=299; Antisense; GACCGCACGACGACAGTGGATTCAA
>probe:Drosophila_2:1630103_at:368:107; Interrogation_Position=338; Antisense; AGAAACACTTTCATCGCACATCGTT
>probe:Drosophila_2:1630103_at:513:43; Interrogation_Position=350; Antisense; ATCGCACATCGTTGCTGATTAAAGC
>probe:Drosophila_2:1630103_at:66:345; Interrogation_Position=373; Antisense; GCATTTAACCACAAATTTCGCTTGG
>probe:Drosophila_2:1630103_at:437:693; Interrogation_Position=388; Antisense; TTTCGCTTGGACTTGGAGCTCAATT
>probe:Drosophila_2:1630103_at:457:549; Interrogation_Position=402; Antisense; GGAGCTCAATTCACAACTTCTTTCG
>probe:Drosophila_2:1630103_at:616:11; Interrogation_Position=410; Antisense; ATTCACAACTTCTTTCGCCAAACAT
>probe:Drosophila_2:1630103_at:80:149; Interrogation_Position=417; Antisense; ACTTCTTTCGCCAAACATACAACAG
>probe:Drosophila_2:1630103_at:205:191; Interrogation_Position=430; Antisense; AACATACAACAGAAACACTACCACG

Paste this into a BLAST search page for me
AAGATGGGCATATCCACGCGCGAAGTGGGCATATCCACGCGCGAAGTCAGGCGAAGTCAGTCTCCCGAAGCCGGGGAAGCCGGGACAAAGACCTCGACCGGGGACAAAGACCTCGACCGCACGACGACCGCACGACGACAGTGGATTCAAAGAAACACTTTCATCGCACATCGTTATCGCACATCGTTGCTGATTAAAGCGCATTTAACCACAAATTTCGCTTGGTTTCGCTTGGACTTGGAGCTCAATTGGAGCTCAATTCACAACTTCTTTCGATTCACAACTTCTTTCGCCAAACATACTTCTTTCGCCAAACATACAACAGAACATACAACAGAAACACTACCACG

Full Affymetrix probeset data:

Annotations for 1630103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720