Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630106_at:

>probe:Drosophila_2:1630106_at:694:209; Interrogation_Position=3206; Antisense; AAGAGCACCAGCAAACTCCTATACG
>probe:Drosophila_2:1630106_at:46:217; Interrogation_Position=3288; Antisense; AAGTAGCCCTGGATGCGGAGACCGA
>probe:Drosophila_2:1630106_at:160:425; Interrogation_Position=3305; Antisense; GAGACCGAGGGCTATACGCTGATGA
>probe:Drosophila_2:1630106_at:132:361; Interrogation_Position=3350; Antisense; GAATCCTCGCCCTGGAAATCGGACA
>probe:Drosophila_2:1630106_at:730:153; Interrogation_Position=3372; Antisense; ACAGATCGGATGAGCGTGTCCAGGC
>probe:Drosophila_2:1630106_at:234:517; Interrogation_Position=3387; Antisense; GTGTCCAGGCGCTCAGCATCATCAT
>probe:Drosophila_2:1630106_at:668:35; Interrogation_Position=3407; Antisense; ATCATGCTGTACTTGTGCACGGGTC
>probe:Drosophila_2:1630106_at:61:287; Interrogation_Position=3426; Antisense; CGGGTCTGCAACATGCCCAGGGTGT
>probe:Drosophila_2:1630106_at:542:361; Interrogation_Position=3472; Antisense; GCAATCCTGGGATCATGGGCTACAT
>probe:Drosophila_2:1630106_at:698:239; Interrogation_Position=3508; Antisense; AATACTTGTGTATTCGCGTGAACTC
>probe:Drosophila_2:1630106_at:388:635; Interrogation_Position=3521; Antisense; TCGCGTGAACTCGTACATAATCTTA
>probe:Drosophila_2:1630106_at:582:343; Interrogation_Position=3581; Antisense; GCATTTTTAATTCGTGTTGTGGCAT
>probe:Drosophila_2:1630106_at:727:247; Interrogation_Position=3629; Antisense; CAATTTTAGCCATTCGTTTCGATCA
>probe:Drosophila_2:1630106_at:449:567; Interrogation_Position=3735; Antisense; GGCATCCATAGAGTTCCAACTTGTT

Paste this into a BLAST search page for me
AAGAGCACCAGCAAACTCCTATACGAAGTAGCCCTGGATGCGGAGACCGAGAGACCGAGGGCTATACGCTGATGAGAATCCTCGCCCTGGAAATCGGACAACAGATCGGATGAGCGTGTCCAGGCGTGTCCAGGCGCTCAGCATCATCATATCATGCTGTACTTGTGCACGGGTCCGGGTCTGCAACATGCCCAGGGTGTGCAATCCTGGGATCATGGGCTACATAATACTTGTGTATTCGCGTGAACTCTCGCGTGAACTCGTACATAATCTTAGCATTTTTAATTCGTGTTGTGGCATCAATTTTAGCCATTCGTTTCGATCAGGCATCCATAGAGTTCCAACTTGTT

Full Affymetrix probeset data:

Annotations for 1630106_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime