FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630107_at:

>probe:Drosophila_2:1630107_at:705:327; Interrogation_Position=140; Antisense; GCGTTTGCTTGCGTTTGGAGTATTT
>probe:Drosophila_2:1630107_at:663:83; Interrogation_Position=166; Antisense; AGTGCTTTGGAATTAGTTCTTCGGG
>probe:Drosophila_2:1630107_at:118:469; Interrogation_Position=181; Antisense; GTTCTTCGGGAATTGAGTAAGCCAA
>probe:Drosophila_2:1630107_at:71:127; Interrogation_Position=200; Antisense; AGCCAATTAGGCTGCAATGGATTAA
>probe:Drosophila_2:1630107_at:124:193; Interrogation_Position=238; Antisense; AAGGACTTAAACGATCTGGAGGATC
>probe:Drosophila_2:1630107_at:183:241; Interrogation_Position=280; Antisense; AATAGCAGCGTCACAGAGGGATTCA
>probe:Drosophila_2:1630107_at:199:435; Interrogation_Position=295; Antisense; GAGGGATTCATTACGATCTTATCGC
>probe:Drosophila_2:1630107_at:607:37; Interrogation_Position=310; Antisense; ATCTTATCGCAAACGCACCACTTTA
>probe:Drosophila_2:1630107_at:146:127; Interrogation_Position=326; Antisense; ACCACTTTATTCACGCCCGATACTA
>probe:Drosophila_2:1630107_at:370:665; Interrogation_Position=346; Antisense; TACTACGCCACTCGCAATGCAAATG
>probe:Drosophila_2:1630107_at:105:505; Interrogation_Position=370; Antisense; GTGCGACTAAAGGATAAGCGGTATT
>probe:Drosophila_2:1630107_at:553:205; Interrogation_Position=385; Antisense; AAGCGGTATTTGTTCCTGTGCGAGG
>probe:Drosophila_2:1630107_at:598:403; Interrogation_Position=409; Antisense; GACGAAAGCCCTGCGGAATTGCTCT
>probe:Drosophila_2:1630107_at:429:363; Interrogation_Position=424; Antisense; GAATTGCTCTGCATGGATATACTGC

Paste this into a BLAST search page for me
GCGTTTGCTTGCGTTTGGAGTATTTAGTGCTTTGGAATTAGTTCTTCGGGGTTCTTCGGGAATTGAGTAAGCCAAAGCCAATTAGGCTGCAATGGATTAAAAGGACTTAAACGATCTGGAGGATCAATAGCAGCGTCACAGAGGGATTCAGAGGGATTCATTACGATCTTATCGCATCTTATCGCAAACGCACCACTTTAACCACTTTATTCACGCCCGATACTATACTACGCCACTCGCAATGCAAATGGTGCGACTAAAGGATAAGCGGTATTAAGCGGTATTTGTTCCTGTGCGAGGGACGAAAGCCCTGCGGAATTGCTCTGAATTGCTCTGCATGGATATACTGC

Full Affymetrix probeset data:

Annotations for 1630107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720