Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630108_a_at:

>probe:Drosophila_2:1630108_a_at:317:51; Interrogation_Position=1018; Antisense; ATGCGAACTTGTTCCGGATCCAGTA
>probe:Drosophila_2:1630108_a_at:391:545; Interrogation_Position=1033; Antisense; GGATCCAGTACCAAACCAGGCGAAA
>probe:Drosophila_2:1630108_a_at:148:179; Interrogation_Position=1055; Antisense; AAACATGGTGAGCATCCTGCGGACC
>probe:Drosophila_2:1630108_a_at:412:331; Interrogation_Position=665; Antisense; GCGGCCGCTGTGGAAAATCCTCAAG
>probe:Drosophila_2:1630108_a_at:304:607; Interrogation_Position=736; Antisense; TGATGCTCTCCCCACTGGAAAGAGA
>probe:Drosophila_2:1630108_a_at:178:685; Interrogation_Position=789; Antisense; TATCAGAACTATTTGGGTCGCAGCT
>probe:Drosophila_2:1630108_a_at:186:113; Interrogation_Position=810; Antisense; AGCTGGACCGATTTTTTCTTTCTGA
>probe:Drosophila_2:1630108_a_at:432:713; Interrogation_Position=825; Antisense; TTCTTTCTGAAAACACTTCGCCGGC
>probe:Drosophila_2:1630108_a_at:192:715; Interrogation_Position=862; Antisense; TTCTAGACAATCATTTCGGCTCCTC
>probe:Drosophila_2:1630108_a_at:705:573; Interrogation_Position=887; Antisense; GGCGGACCGCACCAAGTATCTTGAG
>probe:Drosophila_2:1630108_a_at:175:483; Interrogation_Position=902; Antisense; GTATCTTGAGTATGCGTTCCAGCGC
>probe:Drosophila_2:1630108_a_at:114:659; Interrogation_Position=929; Antisense; TAAGACCTTCACACGGATGCTCCAG
>probe:Drosophila_2:1630108_a_at:289:75; Interrogation_Position=973; Antisense; AGGAGTACTTCCATCGGAATCCCCA
>probe:Drosophila_2:1630108_a_at:650:367; Interrogation_Position=989; Antisense; GAATCCCCAGATAGAGGCTCGCATG

Paste this into a BLAST search page for me
ATGCGAACTTGTTCCGGATCCAGTAGGATCCAGTACCAAACCAGGCGAAAAAACATGGTGAGCATCCTGCGGACCGCGGCCGCTGTGGAAAATCCTCAAGTGATGCTCTCCCCACTGGAAAGAGATATCAGAACTATTTGGGTCGCAGCTAGCTGGACCGATTTTTTCTTTCTGATTCTTTCTGAAAACACTTCGCCGGCTTCTAGACAATCATTTCGGCTCCTCGGCGGACCGCACCAAGTATCTTGAGGTATCTTGAGTATGCGTTCCAGCGCTAAGACCTTCACACGGATGCTCCAGAGGAGTACTTCCATCGGAATCCCCAGAATCCCCAGATAGAGGCTCGCATG

Full Affymetrix probeset data:

Annotations for 1630108_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime