FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630110_at:

>probe:Drosophila_2:1630110_at:398:135; Interrogation_Position=1018; Antisense; ACACTGTATTACGTCCTGGATATGC
>probe:Drosophila_2:1630110_at:314:91; Interrogation_Position=1064; Antisense; AGTTATTCGATTACACGGCGGGCCT
>probe:Drosophila_2:1630110_at:401:539; Interrogation_Position=1175; Antisense; GGCTTAGTAAATGGGCTCCGGCTTC
>probe:Drosophila_2:1630110_at:302:279; Interrogation_Position=621; Antisense; CTACCAGATGCTTAACTTTTTCGGG
>probe:Drosophila_2:1630110_at:221:603; Interrogation_Position=657; Antisense; TGTTTTCTGGACATATCTCTCGCAC
>probe:Drosophila_2:1630110_at:74:711; Interrogation_Position=688; Antisense; TTCACGACGCTTAAGGATGCTCCAG
>probe:Drosophila_2:1630110_at:291:273; Interrogation_Position=786; Antisense; CATTACAGCCTGTAGCTTTCTGATA
>probe:Drosophila_2:1630110_at:727:569; Interrogation_Position=817; Antisense; GGCATACTGTTTGCTGTCTGGATGT
>probe:Drosophila_2:1630110_at:394:499; Interrogation_Position=832; Antisense; GTCTGGATGTTTACCCTGCGATCGG
>probe:Drosophila_2:1630110_at:517:41; Interrogation_Position=852; Antisense; ATCGGTGCGTTTTCTTATCTTGAGA
>probe:Drosophila_2:1630110_at:221:649; Interrogation_Position=885; Antisense; TCAGAGCGTTTCCTTTGTGACCTAC
>probe:Drosophila_2:1630110_at:267:565; Interrogation_Position=923; Antisense; GGAATCGCATTATGACCGTGCCATT
>probe:Drosophila_2:1630110_at:299:11; Interrogation_Position=945; Antisense; ATTAAAGTGCGTCTCCGCCGAGGAA
>probe:Drosophila_2:1630110_at:157:561; Interrogation_Position=974; Antisense; GGAACATGGCCAGGGTGCAGCTACC

Paste this into a BLAST search page for me
ACACTGTATTACGTCCTGGATATGCAGTTATTCGATTACACGGCGGGCCTGGCTTAGTAAATGGGCTCCGGCTTCCTACCAGATGCTTAACTTTTTCGGGTGTTTTCTGGACATATCTCTCGCACTTCACGACGCTTAAGGATGCTCCAGCATTACAGCCTGTAGCTTTCTGATAGGCATACTGTTTGCTGTCTGGATGTGTCTGGATGTTTACCCTGCGATCGGATCGGTGCGTTTTCTTATCTTGAGATCAGAGCGTTTCCTTTGTGACCTACGGAATCGCATTATGACCGTGCCATTATTAAAGTGCGTCTCCGCCGAGGAAGGAACATGGCCAGGGTGCAGCTACC

Full Affymetrix probeset data:

Annotations for 1630110_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720