FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630113_at:

>probe:Drosophila_2:1630113_at:591:399; Interrogation_Position=1020; Antisense; GACACCTGTGGATATTTCACTGCCC
>probe:Drosophila_2:1630113_at:623:1; Interrogation_Position=1115; Antisense; ATTGGCAACGGATGACCGCCGAAGT
>probe:Drosophila_2:1630113_at:96:533; Interrogation_Position=1200; Antisense; GGTGACCACCACACGGATGCGTTGC
>probe:Drosophila_2:1630113_at:641:441; Interrogation_Position=1215; Antisense; GATGCGTTGCTCCAATAAGGTCAAG
>probe:Drosophila_2:1630113_at:291:295; Interrogation_Position=1259; Antisense; CGAGCTCCGGTGTGTATGTGAAGAC
>probe:Drosophila_2:1630113_at:486:63; Interrogation_Position=1274; Antisense; ATGTGAAGACCACGGCCTTCGAGCA
>probe:Drosophila_2:1630113_at:157:637; Interrogation_Position=1292; Antisense; TCGAGCACGGCATCTACATAGACGC
>probe:Drosophila_2:1630113_at:36:97; Interrogation_Position=1386; Antisense; AGATATACCGCTCCAGAGACTCGAT
>probe:Drosophila_2:1630113_at:342:589; Interrogation_Position=1415; Antisense; TGGAGGACATCGTGCTGCGCATCAC
>probe:Drosophila_2:1630113_at:697:623; Interrogation_Position=1430; Antisense; TGCGCATCACATTGGCCACCAAGAA
>probe:Drosophila_2:1630113_at:428:211; Interrogation_Position=1462; Antisense; AAGAAACTGGTGCTCGGCACCGTCA
>probe:Drosophila_2:1630113_at:208:355; Interrogation_Position=1478; Antisense; GCACCGTCATAGTCGGCGGAGATCA
>probe:Drosophila_2:1630113_at:156:421; Interrogation_Position=1522; Antisense; GAGCAGATGCGACTCATCCGGGAAT
>probe:Drosophila_2:1630113_at:629:279; Interrogation_Position=991; Antisense; CTCGAGGTGCGAGATCTCCTGGAAT

Paste this into a BLAST search page for me
GACACCTGTGGATATTTCACTGCCCATTGGCAACGGATGACCGCCGAAGTGGTGACCACCACACGGATGCGTTGCGATGCGTTGCTCCAATAAGGTCAAGCGAGCTCCGGTGTGTATGTGAAGACATGTGAAGACCACGGCCTTCGAGCATCGAGCACGGCATCTACATAGACGCAGATATACCGCTCCAGAGACTCGATTGGAGGACATCGTGCTGCGCATCACTGCGCATCACATTGGCCACCAAGAAAAGAAACTGGTGCTCGGCACCGTCAGCACCGTCATAGTCGGCGGAGATCAGAGCAGATGCGACTCATCCGGGAATCTCGAGGTGCGAGATCTCCTGGAAT

Full Affymetrix probeset data:

Annotations for 1630113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720