FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630115_at:

>probe:Drosophila_2:1630115_at:651:293; Interrogation_Position=340; Antisense; CGAGTTGATGCCACCGATGATGAGA
>probe:Drosophila_2:1630115_at:692:211; Interrogation_Position=418; Antisense; AAGAAAGATCTGCTACTGTCCACCG
>probe:Drosophila_2:1630115_at:320:57; Interrogation_Position=466; Antisense; ATGAGGGACTTGCTCGCACAATTCG
>probe:Drosophila_2:1630115_at:503:467; Interrogation_Position=490; Antisense; GTTGACGAAGCCCAACTGGATCAAA
>probe:Drosophila_2:1630115_at:233:435; Interrogation_Position=528; Antisense; GAGGGATGACTCAATTTCCGACATT
>probe:Drosophila_2:1630115_at:190:7; Interrogation_Position=550; Antisense; ATTGAGAGACGTCTGCGAGCTCTGC
>probe:Drosophila_2:1630115_at:361:53; Interrogation_Position=596; Antisense; ATGCATGCCCATCGAGATCCCAGAT
>probe:Drosophila_2:1630115_at:257:437; Interrogation_Position=643; Antisense; GAGGATGACGAGACACTTCTACAGA
>probe:Drosophila_2:1630115_at:136:59; Interrogation_Position=683; Antisense; ATGTAGCAGAATCGCGCTTACCAGA
>probe:Drosophila_2:1630115_at:147:341; Interrogation_Position=698; Antisense; GCTTACCAGAACCTTCCGAGAGTGA
>probe:Drosophila_2:1630115_at:488:85; Interrogation_Position=727; Antisense; AGTCCAATTAACACTGAGTCGCCCG
>probe:Drosophila_2:1630115_at:351:561; Interrogation_Position=825; Antisense; GGAACTCTTTTGCACTCTATGCTAT
>probe:Drosophila_2:1630115_at:134:611; Interrogation_Position=867; Antisense; TGACGAGGAGTACCGTGCTCACGTT
>probe:Drosophila_2:1630115_at:587:7; Interrogation_Position=902; Antisense; ATTCGGCTCCGCCAAAGCTTAAAGA

Paste this into a BLAST search page for me
CGAGTTGATGCCACCGATGATGAGAAAGAAAGATCTGCTACTGTCCACCGATGAGGGACTTGCTCGCACAATTCGGTTGACGAAGCCCAACTGGATCAAAGAGGGATGACTCAATTTCCGACATTATTGAGAGACGTCTGCGAGCTCTGCATGCATGCCCATCGAGATCCCAGATGAGGATGACGAGACACTTCTACAGAATGTAGCAGAATCGCGCTTACCAGAGCTTACCAGAACCTTCCGAGAGTGAAGTCCAATTAACACTGAGTCGCCCGGGAACTCTTTTGCACTCTATGCTATTGACGAGGAGTACCGTGCTCACGTTATTCGGCTCCGCCAAAGCTTAAAGA

Full Affymetrix probeset data:

Annotations for 1630115_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720