FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630116_at:

>probe:Drosophila_2:1630116_at:418:457; Interrogation_Position=100; Antisense; GATAGCTTTTATGCGCCGACCTTGG
>probe:Drosophila_2:1630116_at:536:305; Interrogation_Position=119; Antisense; CCTTGGAGGCCGGATTACTGGATTT
>probe:Drosophila_2:1630116_at:125:145; Interrogation_Position=157; Antisense; ACTGCGACCCATGCCAATTTAACGG
>probe:Drosophila_2:1630116_at:690:631; Interrogation_Position=176; Antisense; TAACGGCGGAAAGAGTCCTCGTCCT
>probe:Drosophila_2:1630116_at:566:181; Interrogation_Position=212; Antisense; AAAACTACAGCTATCGATCGACCTC
>probe:Drosophila_2:1630116_at:674:25; Interrogation_Position=241; Antisense; ATAGTCCTCATGGTTTCCGCCTGGA
>probe:Drosophila_2:1630116_at:226:647; Interrogation_Position=272; Antisense; TCATTCTGGGCTTTGTCTTCTGCTG
>probe:Drosophila_2:1630116_at:449:399; Interrogation_Position=339; Antisense; GACACGGTCCAGCATCGATATCGAT
>probe:Drosophila_2:1630116_at:656:225; Interrogation_Position=391; Antisense; AATGGAAATGGGAGTGCCTCCGCCC
>probe:Drosophila_2:1630116_at:244:195; Interrogation_Position=423; Antisense; AACTGCAGCCACAGGGATATCCAAG
>probe:Drosophila_2:1630116_at:357:221; Interrogation_Position=44; Antisense; AAGTGCAACCATACCTGCATGTGGT
>probe:Drosophila_2:1630116_at:729:509; Interrogation_Position=459; Antisense; GTGCAATATACTCTACGATTCGGTT
>probe:Drosophila_2:1630116_at:671:397; Interrogation_Position=70; Antisense; GACAGTGGTTATGCAGCTTTAGCCC
>probe:Drosophila_2:1630116_at:371:341; Interrogation_Position=85; Antisense; GCTTTAGCCCATGTCGATAGCTTTT

Paste this into a BLAST search page for me
GATAGCTTTTATGCGCCGACCTTGGCCTTGGAGGCCGGATTACTGGATTTACTGCGACCCATGCCAATTTAACGGTAACGGCGGAAAGAGTCCTCGTCCTAAAACTACAGCTATCGATCGACCTCATAGTCCTCATGGTTTCCGCCTGGATCATTCTGGGCTTTGTCTTCTGCTGGACACGGTCCAGCATCGATATCGATAATGGAAATGGGAGTGCCTCCGCCCAACTGCAGCCACAGGGATATCCAAGAAGTGCAACCATACCTGCATGTGGTGTGCAATATACTCTACGATTCGGTTGACAGTGGTTATGCAGCTTTAGCCCGCTTTAGCCCATGTCGATAGCTTTT

Full Affymetrix probeset data:

Annotations for 1630116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720