Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630117_at:

>probe:Drosophila_2:1630117_at:23:43; Interrogation_Position=122; Antisense; ATCGTCATCATCATGAGGACTCCAA
>probe:Drosophila_2:1630117_at:594:111; Interrogation_Position=147; Antisense; AGCAAAACAGTTTCCAGCGGGCGAG
>probe:Drosophila_2:1630117_at:88:627; Interrogation_Position=159; Antisense; TCCAGCGGGCGAGGAGGAATCCCAT
>probe:Drosophila_2:1630117_at:173:673; Interrogation_Position=17; Antisense; TAGCCAGCCACGTGGACGTGGACCA
>probe:Drosophila_2:1630117_at:231:439; Interrogation_Position=172; Antisense; GAGGAATCCCATTCATCGGGCGAGA
>probe:Drosophila_2:1630117_at:347:185; Interrogation_Position=203; Antisense; AAAATCATTGGAACGACGCCCGCAT
>probe:Drosophila_2:1630117_at:317:347; Interrogation_Position=224; Antisense; GCATCTTCTCGGGTCACTGTCATCA
>probe:Drosophila_2:1630117_at:268:291; Interrogation_Position=233; Antisense; CGGGTCACTGTCATCAGCTGGCGGA
>probe:Drosophila_2:1630117_at:716:253; Interrogation_Position=259; Antisense; CAACTGGCCCTCGATTTCAATAAGA
>probe:Drosophila_2:1630117_at:213:711; Interrogation_Position=274; Antisense; TTCAATAAGACCGTCGTCCTGTGGC
>probe:Drosophila_2:1630117_at:397:577; Interrogation_Position=296; Antisense; GGCCCTGTCCGCGAATGAAAGTGAG
>probe:Drosophila_2:1630117_at:63:419; Interrogation_Position=311; Antisense; TGAAAGTGAGTACGTCCTTAGTTTA
>probe:Drosophila_2:1630117_at:572:247; Interrogation_Position=43; Antisense; AATTCCACTATCTACATTGGCACGC
>probe:Drosophila_2:1630117_at:716:111; Interrogation_Position=83; Antisense; AGCAACATCGGCTGCATTCAAAGCA

Paste this into a BLAST search page for me
ATCGTCATCATCATGAGGACTCCAAAGCAAAACAGTTTCCAGCGGGCGAGTCCAGCGGGCGAGGAGGAATCCCATTAGCCAGCCACGTGGACGTGGACCAGAGGAATCCCATTCATCGGGCGAGAAAAATCATTGGAACGACGCCCGCATGCATCTTCTCGGGTCACTGTCATCACGGGTCACTGTCATCAGCTGGCGGACAACTGGCCCTCGATTTCAATAAGATTCAATAAGACCGTCGTCCTGTGGCGGCCCTGTCCGCGAATGAAAGTGAGTGAAAGTGAGTACGTCCTTAGTTTAAATTCCACTATCTACATTGGCACGCAGCAACATCGGCTGCATTCAAAGCA

Full Affymetrix probeset data:

Annotations for 1630117_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime