Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630121_at:

>probe:Drosophila_2:1630121_at:648:421; Interrogation_Position=3131; Antisense; GAGCAATCTATCGAACATCCCAAAA
>probe:Drosophila_2:1630121_at:372:43; Interrogation_Position=3147; Antisense; ATCCCAAAAACTGTTGCTGTCGCGA
>probe:Drosophila_2:1630121_at:114:503; Interrogation_Position=3165; Antisense; GTCGCGATGCCGAGGAGGATTCCAT
>probe:Drosophila_2:1630121_at:383:39; Interrogation_Position=3197; Antisense; ATCGGGTCCCGAATGCCGGTCAAAT
>probe:Drosophila_2:1630121_at:376:161; Interrogation_Position=3217; Antisense; CAAATTTCCCGGCTTTAGTCGAGCG
>probe:Drosophila_2:1630121_at:493:81; Interrogation_Position=3272; Antisense; AGTGGAACCGTGGAGAGCCTGAACC
>probe:Drosophila_2:1630121_at:65:671; Interrogation_Position=3359; Antisense; TACGTGGTCTTCAGGCATCATCCCA
>probe:Drosophila_2:1630121_at:429:541; Interrogation_Position=3405; Antisense; GGTTCTATGTTTTCGATGGCTGCAC
>probe:Drosophila_2:1630121_at:173:141; Interrogation_Position=3467; Antisense; ACGGGCACGGCTGGATTGATCGCTT
>probe:Drosophila_2:1630121_at:188:543; Interrogation_Position=3479; Antisense; GGATTGATCGCTTTCCGCAAGCAAT
>probe:Drosophila_2:1630121_at:321:361; Interrogation_Position=3499; Antisense; GCAATCCGAGGTTGTGTGCCACATT
>probe:Drosophila_2:1630121_at:435:597; Interrogation_Position=3513; Antisense; TGTGCCACATTATCGATTCGCGGGA
>probe:Drosophila_2:1630121_at:250:423; Interrogation_Position=3539; Antisense; GAGAAGGCCCTCAAGATGCTGCGCT
>probe:Drosophila_2:1630121_at:589:455; Interrogation_Position=3592; Antisense; GATACAAAGGCTGTTGGCTCGCTGA

Paste this into a BLAST search page for me
GAGCAATCTATCGAACATCCCAAAAATCCCAAAAACTGTTGCTGTCGCGAGTCGCGATGCCGAGGAGGATTCCATATCGGGTCCCGAATGCCGGTCAAATCAAATTTCCCGGCTTTAGTCGAGCGAGTGGAACCGTGGAGAGCCTGAACCTACGTGGTCTTCAGGCATCATCCCAGGTTCTATGTTTTCGATGGCTGCACACGGGCACGGCTGGATTGATCGCTTGGATTGATCGCTTTCCGCAAGCAATGCAATCCGAGGTTGTGTGCCACATTTGTGCCACATTATCGATTCGCGGGAGAGAAGGCCCTCAAGATGCTGCGCTGATACAAAGGCTGTTGGCTCGCTGA

Full Affymetrix probeset data:

Annotations for 1630121_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime