FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630122_at:

>probe:Drosophila_2:1630122_at:500:327; Interrogation_Position=1038; Antisense; GCGATATTTTACAAGTGGCTGCCAA
>probe:Drosophila_2:1630122_at:682:393; Interrogation_Position=1184; Antisense; GAAATGTCTGACCTACTACAACCAA
>probe:Drosophila_2:1630122_at:286:523; Interrogation_Position=1230; Antisense; GTGGCCAATTCAATGTCCTACATGA
>probe:Drosophila_2:1630122_at:271:153; Interrogation_Position=1249; Antisense; ACATGATTTGGTTCTACTGCCTTCT
>probe:Drosophila_2:1630122_at:641:627; Interrogation_Position=1266; Antisense; TGCCTTCTCCTACAGCTGACAAGAT
>probe:Drosophila_2:1630122_at:55:529; Interrogation_Position=1319; Antisense; GGGATTTATGACTGTTTCCACCCTG
>probe:Drosophila_2:1630122_at:388:479; Interrogation_Position=1332; Antisense; GTTTCCACCCTGATATTAGCCATGA
>probe:Drosophila_2:1630122_at:235:171; Interrogation_Position=1391; Antisense; AAAGGTGCCGCATATCGCAGCATTT
>probe:Drosophila_2:1630122_at:283:71; Interrogation_Position=1453; Antisense; AGGCTGAACGTCCTGACATCGACAT
>probe:Drosophila_2:1630122_at:213:57; Interrogation_Position=1476; Antisense; ATGATCCCCGAGTCTGGACATTCAA
>probe:Drosophila_2:1630122_at:620:185; Interrogation_Position=912; Antisense; AACAATCTAGCCCTAATGCCAGTGG
>probe:Drosophila_2:1630122_at:4:49; Interrogation_Position=927; Antisense; ATGCCAGTGGGTTATCTCAACGTGA
>probe:Drosophila_2:1630122_at:247:207; Interrogation_Position=964; Antisense; AAGCGGTGGCTTTACATCTCAACGT
>probe:Drosophila_2:1630122_at:200:653; Interrogation_Position=982; Antisense; TCAACGTCTTGCAACTTTTGTCGCA

Paste this into a BLAST search page for me
GCGATATTTTACAAGTGGCTGCCAAGAAATGTCTGACCTACTACAACCAAGTGGCCAATTCAATGTCCTACATGAACATGATTTGGTTCTACTGCCTTCTTGCCTTCTCCTACAGCTGACAAGATGGGATTTATGACTGTTTCCACCCTGGTTTCCACCCTGATATTAGCCATGAAAAGGTGCCGCATATCGCAGCATTTAGGCTGAACGTCCTGACATCGACATATGATCCCCGAGTCTGGACATTCAAAACAATCTAGCCCTAATGCCAGTGGATGCCAGTGGGTTATCTCAACGTGAAAGCGGTGGCTTTACATCTCAACGTTCAACGTCTTGCAACTTTTGTCGCA

Full Affymetrix probeset data:

Annotations for 1630122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720