FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630123_at:

>probe:Drosophila_2:1630123_at:188:605; Interrogation_Position=1037; Antisense; TGATCGTTTGGTTCTGGCAGGTTAT
>probe:Drosophila_2:1630123_at:695:347; Interrogation_Position=1053; Antisense; GCAGGTTATCGAGCGCTTTAGCAAC
>probe:Drosophila_2:1630123_at:632:499; Interrogation_Position=1091; Antisense; GTCTGCTTCAGTTCGTGACTGGCAC
>probe:Drosophila_2:1630123_at:508:583; Interrogation_Position=1110; Antisense; TGGCACGTCGAGCATACCGTACGAA
>probe:Drosophila_2:1630123_at:515:219; Interrogation_Position=1133; Antisense; AAGGATTCTCGGCATTACGCGGATC
>probe:Drosophila_2:1630123_at:340:321; Interrogation_Position=1163; Antisense; GCCCGAGGCGTTTCTGCATCGAGAA
>probe:Drosophila_2:1630123_at:551:255; Interrogation_Position=1219; Antisense; CACACATGCTTCAATCGGCTGGATT
>probe:Drosophila_2:1630123_at:462:187; Interrogation_Position=1257; Antisense; AACACCCGAACTGCTGTACGAGAAG
>probe:Drosophila_2:1630123_at:180:437; Interrogation_Position=1297; Antisense; GAGGAGACCAACACGTTCGGCATTG
>probe:Drosophila_2:1630123_at:414:125; Interrogation_Position=773; Antisense; AGCCCGGTGGCAAGAATATCATCAT
>probe:Drosophila_2:1630123_at:258:623; Interrogation_Position=884; Antisense; TGCGCGGCTTTTACGAGGTGATCGA
>probe:Drosophila_2:1630123_at:617:479; Interrogation_Position=919; Antisense; GTTTCCGTCTTTGATGCCCGAGAGT
>probe:Drosophila_2:1630123_at:556:93; Interrogation_Position=941; Antisense; AGTTGGAGCTGGTTATTGCCGGCAC
>probe:Drosophila_2:1630123_at:95:399; Interrogation_Position=976; Antisense; GACACAAACGATTGGCGCCTGAACA

Paste this into a BLAST search page for me
TGATCGTTTGGTTCTGGCAGGTTATGCAGGTTATCGAGCGCTTTAGCAACGTCTGCTTCAGTTCGTGACTGGCACTGGCACGTCGAGCATACCGTACGAAAAGGATTCTCGGCATTACGCGGATCGCCCGAGGCGTTTCTGCATCGAGAACACACATGCTTCAATCGGCTGGATTAACACCCGAACTGCTGTACGAGAAGGAGGAGACCAACACGTTCGGCATTGAGCCCGGTGGCAAGAATATCATCATTGCGCGGCTTTTACGAGGTGATCGAGTTTCCGTCTTTGATGCCCGAGAGTAGTTGGAGCTGGTTATTGCCGGCACGACACAAACGATTGGCGCCTGAACA

Full Affymetrix probeset data:

Annotations for 1630123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720