Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630124_at:

>probe:Drosophila_2:1630124_at:358:349; Interrogation_Position=3712; Antisense; GCAGGAGCATGCTGTATGAAGCCAC
>probe:Drosophila_2:1630124_at:582:75; Interrogation_Position=3714; Antisense; AGGAGCATGCTGTATGAAGCCACCA
>probe:Drosophila_2:1630124_at:256:419; Interrogation_Position=3716; Antisense; GAGCATGCTGTATGAAGCCACCACT
>probe:Drosophila_2:1630124_at:275:347; Interrogation_Position=3718; Antisense; GCATGCTGTATGAAGCCACCACTAG
>probe:Drosophila_2:1630124_at:637:333; Interrogation_Position=3722; Antisense; GCTGTATGAAGCCACCACTAGTAGT
>probe:Drosophila_2:1630124_at:43:479; Interrogation_Position=3725; Antisense; GTATGAAGCCACCACTAGTAGTCCT
>probe:Drosophila_2:1630124_at:592:611; Interrogation_Position=3728; Antisense; TGAAGCCACCACTAGTAGTCCTAAC
>probe:Drosophila_2:1630124_at:619:309; Interrogation_Position=3732; Antisense; GCCACCACTAGTAGTCCTAACCAAA
>probe:Drosophila_2:1630124_at:138:277; Interrogation_Position=3739; Antisense; CTAGTAGTCCTAACCAAACCGCAAT
>probe:Drosophila_2:1630124_at:651:659; Interrogation_Position=3740; Antisense; TAGTAGTCCTAACCAAACCGCAATG
>probe:Drosophila_2:1630124_at:554:475; Interrogation_Position=3742; Antisense; GTAGTCCTAACCAAACCGCAATGGA
>probe:Drosophila_2:1630124_at:448:495; Interrogation_Position=3745; Antisense; GTCCTAACCAAACCGCAATGGAGCT
>probe:Drosophila_2:1630124_at:80:659; Interrogation_Position=3749; Antisense; TAACCAAACCGCAATGGAGCTGGAC
>probe:Drosophila_2:1630124_at:381:175; Interrogation_Position=3754; Antisense; AAACCGCAATGGAGCTGGACGCCCT

Paste this into a BLAST search page for me
GCAGGAGCATGCTGTATGAAGCCACAGGAGCATGCTGTATGAAGCCACCAGAGCATGCTGTATGAAGCCACCACTGCATGCTGTATGAAGCCACCACTAGGCTGTATGAAGCCACCACTAGTAGTGTATGAAGCCACCACTAGTAGTCCTTGAAGCCACCACTAGTAGTCCTAACGCCACCACTAGTAGTCCTAACCAAACTAGTAGTCCTAACCAAACCGCAATTAGTAGTCCTAACCAAACCGCAATGGTAGTCCTAACCAAACCGCAATGGAGTCCTAACCAAACCGCAATGGAGCTTAACCAAACCGCAATGGAGCTGGACAAACCGCAATGGAGCTGGACGCCCT

Full Affymetrix probeset data:

Annotations for 1630124_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime