FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630126_at:

>probe:Drosophila_2:1630126_at:659:1; Interrogation_Position=103; Antisense; GTTCCCAGTTACTCCGGAAGCAGTG
>probe:Drosophila_2:1630126_at:310:563; Interrogation_Position=118; Antisense; GGAAGCAGTGTTGGCGACTCCTACG
>probe:Drosophila_2:1630126_at:225:729; Interrogation_Position=128; Antisense; TTGGCGACTCCTACGATGGTGCTGC
>probe:Drosophila_2:1630126_at:431:65; Interrogation_Position=143; Antisense; ATGGTGCTGCCAGCAGCCCGGACTA
>probe:Drosophila_2:1630126_at:636:667; Interrogation_Position=166; Antisense; TACTCGGTCTCCAGCGAACTGAACA
>probe:Drosophila_2:1630126_at:346:147; Interrogation_Position=197; Antisense; ACTACACCTTCGAGGCTGACGAGAG
>probe:Drosophila_2:1630126_at:553:409; Interrogation_Position=214; Antisense; GACGAGAGCCAGTTCGAGGATCCTC
>probe:Drosophila_2:1630126_at:368:215; Interrogation_Position=250; Antisense; AAGATCGCCGGCTCCGTGAACAAGG
>probe:Drosophila_2:1630126_at:355:645; Interrogation_Position=377; Antisense; TCTTGAACAAGCAGACCGACATTGG
>probe:Drosophila_2:1630126_at:119:107; Interrogation_Position=434; Antisense; AGAACTCCAACCAGCGTCCTGAGGT
>probe:Drosophila_2:1630126_at:105:129; Interrogation_Position=443; Antisense; ACCAGCGTCCTGAGGTGCACTTCGT
>probe:Drosophila_2:1630126_at:693:151; Interrogation_Position=473; Antisense; ACAGGACTCCCGAGGATGCGGCCAA
>probe:Drosophila_2:1630126_at:465:87; Interrogation_Position=548; Antisense; AGTCCATCAACGGAGGAGTTGCCAA
>probe:Drosophila_2:1630126_at:303:437; Interrogation_Position=560; Antisense; GAGGAGTTGCCAACGCCATCAACTT

Paste this into a BLAST search page for me
GTTCCCAGTTACTCCGGAAGCAGTGGGAAGCAGTGTTGGCGACTCCTACGTTGGCGACTCCTACGATGGTGCTGCATGGTGCTGCCAGCAGCCCGGACTATACTCGGTCTCCAGCGAACTGAACAACTACACCTTCGAGGCTGACGAGAGGACGAGAGCCAGTTCGAGGATCCTCAAGATCGCCGGCTCCGTGAACAAGGTCTTGAACAAGCAGACCGACATTGGAGAACTCCAACCAGCGTCCTGAGGTACCAGCGTCCTGAGGTGCACTTCGTACAGGACTCCCGAGGATGCGGCCAAAGTCCATCAACGGAGGAGTTGCCAAGAGGAGTTGCCAACGCCATCAACTT

Full Affymetrix probeset data:

Annotations for 1630126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720