Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630129_at:

>probe:Drosophila_2:1630129_at:453:597; Interrogation_Position=2401; Antisense; TGTCCGCTCGAAACTTGAAGGCCTT
>probe:Drosophila_2:1630129_at:681:13; Interrogation_Position=2443; Antisense; ATTACTTTAGGAATGAGGTGCGCCA
>probe:Drosophila_2:1630129_at:629:625; Interrogation_Position=2493; Antisense; TGCCCGTGCTACTAGTCACACAAAA
>probe:Drosophila_2:1630129_at:557:179; Interrogation_Position=2515; Antisense; AAACAATCGAAACCAGAATCCCAGT
>probe:Drosophila_2:1630129_at:319:367; Interrogation_Position=2530; Antisense; GAATCCCAGTTCAATGACCCATCAT
>probe:Drosophila_2:1630129_at:363:647; Interrogation_Position=2551; Antisense; TCATCACACACATACCGACATCTAA
>probe:Drosophila_2:1630129_at:262:401; Interrogation_Position=2567; Antisense; GACATCTAACTTGTACTAACCAGAA
>probe:Drosophila_2:1630129_at:234:385; Interrogation_Position=2601; Antisense; GAACATTTTTCAACGTTGTCTACCA
>probe:Drosophila_2:1630129_at:359:61; Interrogation_Position=2703; Antisense; ATGTACATACATACGACGTTCTCTG
>probe:Drosophila_2:1630129_at:404:409; Interrogation_Position=2717; Antisense; GACGTTCTCTGTTTCTTGCGAGGAG
>probe:Drosophila_2:1630129_at:585:507; Interrogation_Position=2743; Antisense; GGGCGAGGACCACTAATAAGAACTT
>probe:Drosophila_2:1630129_at:126:693; Interrogation_Position=2770; Antisense; TTTGTTTGCTCATCTTTTCTACCAC
>probe:Drosophila_2:1630129_at:645:693; Interrogation_Position=2785; Antisense; TTTCTACCACGTAAGGCAAAGCGAG
>probe:Drosophila_2:1630129_at:463:725; Interrogation_Position=2914; Antisense; TTGAAATGCGAGTACTTAGCCAGAA

Paste this into a BLAST search page for me
TGTCCGCTCGAAACTTGAAGGCCTTATTACTTTAGGAATGAGGTGCGCCATGCCCGTGCTACTAGTCACACAAAAAAACAATCGAAACCAGAATCCCAGTGAATCCCAGTTCAATGACCCATCATTCATCACACACATACCGACATCTAAGACATCTAACTTGTACTAACCAGAAGAACATTTTTCAACGTTGTCTACCAATGTACATACATACGACGTTCTCTGGACGTTCTCTGTTTCTTGCGAGGAGGGGCGAGGACCACTAATAAGAACTTTTTGTTTGCTCATCTTTTCTACCACTTTCTACCACGTAAGGCAAAGCGAGTTGAAATGCGAGTACTTAGCCAGAA

Full Affymetrix probeset data:

Annotations for 1630129_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime