FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630130_at:

>probe:Drosophila_2:1630130_at:636:399; Interrogation_Position=1141; Antisense; GACAGAAGGTCGTCGGACTCATCGA
>probe:Drosophila_2:1630130_at:579:557; Interrogation_Position=1155; Antisense; GGACTCATCGACGATATTCTGGATA
>probe:Drosophila_2:1630130_at:434:375; Interrogation_Position=1215; Antisense; GAAGATGCTTACGTTTCAGCGATGA
>probe:Drosophila_2:1630130_at:663:141; Interrogation_Position=1256; Antisense; ACGGCTCTATCAAAATTACCACACA
>probe:Drosophila_2:1630130_at:85:175; Interrogation_Position=1346; Antisense; AAACCAACATTTTCACCACTTTCAG
>probe:Drosophila_2:1630130_at:243:259; Interrogation_Position=1362; Antisense; CACTTTCAGATTTCATTCTGGCCAT
>probe:Drosophila_2:1630130_at:526:715; Interrogation_Position=1377; Antisense; TTCTGGCCATCATATTGCTAACTTT
>probe:Drosophila_2:1630130_at:444:43; Interrogation_Position=1467; Antisense; ATCGAAGTTTATATGCACTGCATCG
>probe:Drosophila_2:1630130_at:123:343; Interrogation_Position=1486; Antisense; GCATCGAAATTTGTAAAGCGCCCAG
>probe:Drosophila_2:1630130_at:111:125; Interrogation_Position=1502; Antisense; AGCGCCCAGTGGAACAGGATGAAAT
>probe:Drosophila_2:1630130_at:358:475; Interrogation_Position=1532; Antisense; GTTATGTGATATTTTCTCTCCGTGA
>probe:Drosophila_2:1630130_at:306:365; Interrogation_Position=1573; Antisense; GAATCGAAGAAAACACACCCAGTTG
>probe:Drosophila_2:1630130_at:339:389; Interrogation_Position=1601; Antisense; GAAAACGCCAACAGTGCCCATTTAT
>probe:Drosophila_2:1630130_at:654:5; Interrogation_Position=1660; Antisense; ATTGTTGTTGTTAAGCACACACACA

Paste this into a BLAST search page for me
GACAGAAGGTCGTCGGACTCATCGAGGACTCATCGACGATATTCTGGATAGAAGATGCTTACGTTTCAGCGATGAACGGCTCTATCAAAATTACCACACAAAACCAACATTTTCACCACTTTCAGCACTTTCAGATTTCATTCTGGCCATTTCTGGCCATCATATTGCTAACTTTATCGAAGTTTATATGCACTGCATCGGCATCGAAATTTGTAAAGCGCCCAGAGCGCCCAGTGGAACAGGATGAAATGTTATGTGATATTTTCTCTCCGTGAGAATCGAAGAAAACACACCCAGTTGGAAAACGCCAACAGTGCCCATTTATATTGTTGTTGTTAAGCACACACACA

Full Affymetrix probeset data:

Annotations for 1630130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720