FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630131_at:

>probe:Drosophila_2:1630131_at:138:273; Interrogation_Position=185; Antisense; CTTATCGGCCGGAATCTGGAGTACC
>probe:Drosophila_2:1630131_at:141:587; Interrogation_Position=201; Antisense; TGGAGTACCCGCACATAAAGATAAT
>probe:Drosophila_2:1630131_at:47:211; Interrogation_Position=218; Antisense; AAGATAATATATCCCACGGCTCCCA
>probe:Drosophila_2:1630131_at:359:233; Interrogation_Position=272; Antisense; CTATCCAACGTGTGGTTTGACCGCA
>probe:Drosophila_2:1630131_at:515:479; Interrogation_Position=286; Antisense; GTTTGACCGCAAGTCCGTGAACATT
>probe:Drosophila_2:1630131_at:564:61; Interrogation_Position=335; Antisense; ATGTCCCAGTGTTATGATGCGGTCA
>probe:Drosophila_2:1630131_at:451:445; Interrogation_Position=350; Antisense; GATGCGGTCAATCAGCTGATCGACG
>probe:Drosophila_2:1630131_at:169:153; Interrogation_Position=402; Antisense; ACAGGATCGTTGTGGGCGGATTCTC
>probe:Drosophila_2:1630131_at:724:155; Interrogation_Position=450; Antisense; ACACGGGCTACCATTTGAGACGCAG
>probe:Drosophila_2:1630131_at:103:239; Interrogation_Position=555; Antisense; AATCTTTTCCCGAGCTGCGAATGTA
>probe:Drosophila_2:1630131_at:707:559; Interrogation_Position=586; Antisense; GGAACGCGATACTCTGGTACCTAAG
>probe:Drosophila_2:1630131_at:432:531; Interrogation_Position=650; Antisense; GGTGTCAAGGGCACATTTCATCCAT
>probe:Drosophila_2:1630131_at:625:725; Interrogation_Position=674; Antisense; TTGAGGAACACACTGCACGAACTGA
>probe:Drosophila_2:1630131_at:455:699; Interrogation_Position=732; Antisense; TTTATGAAAAACTACCTCCGCTGGA

Paste this into a BLAST search page for me
CTTATCGGCCGGAATCTGGAGTACCTGGAGTACCCGCACATAAAGATAATAAGATAATATATCCCACGGCTCCCACTATCCAACGTGTGGTTTGACCGCAGTTTGACCGCAAGTCCGTGAACATTATGTCCCAGTGTTATGATGCGGTCAGATGCGGTCAATCAGCTGATCGACGACAGGATCGTTGTGGGCGGATTCTCACACGGGCTACCATTTGAGACGCAGAATCTTTTCCCGAGCTGCGAATGTAGGAACGCGATACTCTGGTACCTAAGGGTGTCAAGGGCACATTTCATCCATTTGAGGAACACACTGCACGAACTGATTTATGAAAAACTACCTCCGCTGGA

Full Affymetrix probeset data:

Annotations for 1630131_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720