Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630132_at:

>probe:Drosophila_2:1630132_at:84:627; Interrogation_Position=1369; Antisense; TGCCGATAAGGCTCTGGTGCCCGGA
>probe:Drosophila_2:1630132_at:2:421; Interrogation_Position=1398; Antisense; GAGCATTCGAGGTGCGCGCGTACAA
>probe:Drosophila_2:1630132_at:643:489; Interrogation_Position=1417; Antisense; GTACAACGAGCTGGTCGCCTTCAAG
>probe:Drosophila_2:1630132_at:632:611; Interrogation_Position=1521; Antisense; TGAACAGCGGCTACGATGCCCAGGA
>probe:Drosophila_2:1630132_at:423:447; Interrogation_Position=1535; Antisense; GATGCCCAGGACACAATCGTCAAGC
>probe:Drosophila_2:1630132_at:147:207; Interrogation_Position=1556; Antisense; AAGCTGACTGTTGAGGATCGCCTGA
>probe:Drosophila_2:1630132_at:678:553; Interrogation_Position=1615; Antisense; GGAGCCCATGAAGCCCGTGGATCTG
>probe:Drosophila_2:1630132_at:602:589; Interrogation_Position=1632; Antisense; TGGATCTGGGCGTCTACGACAACTA
>probe:Drosophila_2:1630132_at:104:211; Interrogation_Position=1664; Antisense; AAGAAGCAGATCCTCAACTCCTGTT
>probe:Drosophila_2:1630132_at:689:143; Interrogation_Position=1680; Antisense; ACTCCTGTTCGATCATTGCCAGCAA
>probe:Drosophila_2:1630132_at:22:203; Interrogation_Position=1703; Antisense; AACCTGCTTCTCGTCGACGAGGTGA
>probe:Drosophila_2:1630132_at:666:49; Interrogation_Position=1727; Antisense; ATGCGTGCGGGCATGACGAGCCTCA
>probe:Drosophila_2:1630132_at:473:695; Interrogation_Position=1769; Antisense; TTTCATCCGACCCATTCAATTTAAC
>probe:Drosophila_2:1630132_at:297:469; Interrogation_Position=1899; Antisense; GTTGCGGCTGCAAGTATTCACATTT

Paste this into a BLAST search page for me
TGCCGATAAGGCTCTGGTGCCCGGAGAGCATTCGAGGTGCGCGCGTACAAGTACAACGAGCTGGTCGCCTTCAAGTGAACAGCGGCTACGATGCCCAGGAGATGCCCAGGACACAATCGTCAAGCAAGCTGACTGTTGAGGATCGCCTGAGGAGCCCATGAAGCCCGTGGATCTGTGGATCTGGGCGTCTACGACAACTAAAGAAGCAGATCCTCAACTCCTGTTACTCCTGTTCGATCATTGCCAGCAAAACCTGCTTCTCGTCGACGAGGTGAATGCGTGCGGGCATGACGAGCCTCATTTCATCCGACCCATTCAATTTAACGTTGCGGCTGCAAGTATTCACATTT

Full Affymetrix probeset data:

Annotations for 1630132_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime