FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630133_at:

>probe:Drosophila_2:1630133_at:569:3; Interrogation_Position=400; Antisense; ATTGGAGCGCTGACCACATCTATTC
>probe:Drosophila_2:1630133_at:606:147; Interrogation_Position=426; Antisense; ACTTTCTTCCCAGTCGAGCGAAGAT
>probe:Drosophila_2:1630133_at:643:677; Interrogation_Position=473; Antisense; TAGAGCGTCTCCTTCGATATGCCAA
>probe:Drosophila_2:1630133_at:250:179; Interrogation_Position=509; Antisense; AAACAGCTCCACTCCGGCAGGTTGA
>probe:Drosophila_2:1630133_at:556:493; Interrogation_Position=554; Antisense; GTCAAATTACACCACCCTATCAGAG
>probe:Drosophila_2:1630133_at:436:117; Interrogation_Position=577; Antisense; AGCTACGATTACCTCCATGAATTTT
>probe:Drosophila_2:1630133_at:28:55; Interrogation_Position=593; Antisense; ATGAATTTTCTCCTGAGCCCATGGC
>probe:Drosophila_2:1630133_at:527:653; Interrogation_Position=635; Antisense; TCAATGAATTCGATGCTAACTGGGC
>probe:Drosophila_2:1630133_at:567:593; Interrogation_Position=671; Antisense; TGGGCCTTGAGCCAACGATTCCTAT
>probe:Drosophila_2:1630133_at:683:385; Interrogation_Position=712; Antisense; GAACACAATACACAGGATCAGCCAA
>probe:Drosophila_2:1630133_at:209:155; Interrogation_Position=741; Antisense; ACAGAATTTCTGCTGGGACTCGAAT
>probe:Drosophila_2:1630133_at:42:557; Interrogation_Position=756; Antisense; GGACTCGAATAGCTCTTCTGCTTCA
>probe:Drosophila_2:1630133_at:723:715; Interrogation_Position=771; Antisense; TTCTGCTTCATCGTCGGATATTTTG
>probe:Drosophila_2:1630133_at:508:421; Interrogation_Position=902; Antisense; GAGCAATATCTTTCTGTGACTACAT

Paste this into a BLAST search page for me
ATTGGAGCGCTGACCACATCTATTCACTTTCTTCCCAGTCGAGCGAAGATTAGAGCGTCTCCTTCGATATGCCAAAAACAGCTCCACTCCGGCAGGTTGAGTCAAATTACACCACCCTATCAGAGAGCTACGATTACCTCCATGAATTTTATGAATTTTCTCCTGAGCCCATGGCTCAATGAATTCGATGCTAACTGGGCTGGGCCTTGAGCCAACGATTCCTATGAACACAATACACAGGATCAGCCAAACAGAATTTCTGCTGGGACTCGAATGGACTCGAATAGCTCTTCTGCTTCATTCTGCTTCATCGTCGGATATTTTGGAGCAATATCTTTCTGTGACTACAT

Full Affymetrix probeset data:

Annotations for 1630133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720