FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630137_at:

>probe:Drosophila_2:1630137_at:240:261; Interrogation_Position=133; Antisense; CACCCAGCATCTTATGTCTCAAAGG
>probe:Drosophila_2:1630137_at:187:433; Interrogation_Position=15; Antisense; GAGTGACTTCAGCATCGAGTATATT
>probe:Drosophila_2:1630137_at:534:547; Interrogation_Position=189; Antisense; GGAGGCTCAGATACCCGTCTACGAT
>probe:Drosophila_2:1630137_at:26:135; Interrogation_Position=209; Antisense; ACGATTGGCTGCAGTACACCCGGTA
>probe:Drosophila_2:1630137_at:494:165; Interrogation_Position=267; Antisense; AAATGCGCCCGCCAAAAGGACTCCT
>probe:Drosophila_2:1630137_at:78:273; Interrogation_Position=306; Antisense; CATACCATTTACTCCGCAGCAGCTG
>probe:Drosophila_2:1630137_at:416:429; Interrogation_Position=31; Antisense; GAGTATATTTTGAACCGAGCCGGCG
>probe:Drosophila_2:1630137_at:302:335; Interrogation_Position=327; Antisense; GCTGCAGGCCCTGGAAAATGCCTAC
>probe:Drosophila_2:1630137_at:227:77; Interrogation_Position=353; Antisense; AGGAGTCCAACTATCTGAGCGCCGA
>probe:Drosophila_2:1630137_at:520:437; Interrogation_Position=376; Antisense; GAGGACGCCAACAAACTAGCCGACT
>probe:Drosophila_2:1630137_at:293:587; Interrogation_Position=404; Antisense; TGGAGCTGACCAATACGCGGGTGAA
>probe:Drosophila_2:1630137_at:628:541; Interrogation_Position=434; Antisense; GGTTCCAGAATCGAAGGGCTCGCGA
>probe:Drosophila_2:1630137_at:389:169; Interrogation_Position=477; Antisense; AAAGGACGAGAGCTGCGACTCCACC
>probe:Drosophila_2:1630137_at:471:287; Interrogation_Position=51; Antisense; CGGCGACAGATACGTGGGCACCAAT

Paste this into a BLAST search page for me
CACCCAGCATCTTATGTCTCAAAGGGAGTGACTTCAGCATCGAGTATATTGGAGGCTCAGATACCCGTCTACGATACGATTGGCTGCAGTACACCCGGTAAAATGCGCCCGCCAAAAGGACTCCTCATACCATTTACTCCGCAGCAGCTGGAGTATATTTTGAACCGAGCCGGCGGCTGCAGGCCCTGGAAAATGCCTACAGGAGTCCAACTATCTGAGCGCCGAGAGGACGCCAACAAACTAGCCGACTTGGAGCTGACCAATACGCGGGTGAAGGTTCCAGAATCGAAGGGCTCGCGAAAAGGACGAGAGCTGCGACTCCACCCGGCGACAGATACGTGGGCACCAAT

Full Affymetrix probeset data:

Annotations for 1630137_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720