FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630138_at:

>probe:Drosophila_2:1630138_at:95:423; Interrogation_Position=110; Antisense; GAGAAAATTGTCGTCCTTGCACCCG
>probe:Drosophila_2:1630138_at:417:319; Interrogation_Position=134; Antisense; GCCGCTTGGTGGATCCTATTAACGA
>probe:Drosophila_2:1630138_at:218:415; Interrogation_Position=145; Antisense; GATCCTATTAACGACCTGGAATTCA
>probe:Drosophila_2:1630138_at:146:167; Interrogation_Position=23; Antisense; AAATGCGGTATCTGTGCGTTTTTTC
>probe:Drosophila_2:1630138_at:197:623; Interrogation_Position=250; Antisense; TGCGAAAATCATGAAACCCGACTGG
>probe:Drosophila_2:1630138_at:455:175; Interrogation_Position=263; Antisense; AAACCCGACTGGATTGCGAGAATGT
>probe:Drosophila_2:1630138_at:9:371; Interrogation_Position=282; Antisense; GAATGTGGCTAGACTAACAGGCATG
>probe:Drosophila_2:1630138_at:110:279; Interrogation_Position=295; Antisense; CTAACAGGCATGAGACGGATTCGTT
>probe:Drosophila_2:1630138_at:4:485; Interrogation_Position=30; Antisense; GTATCTGTGCGTTTTTTCCTTAACA
>probe:Drosophila_2:1630138_at:30:543; Interrogation_Position=311; Antisense; GGATTCGTTGATTTTTCTTAGCTCT
>probe:Drosophila_2:1630138_at:433:719; Interrogation_Position=45; Antisense; TTCCTTAACACTTATCCTTTGCTGC
>probe:Drosophila_2:1630138_at:231:703; Interrogation_Position=56; Antisense; TTATCCTTTGCTGCCTTTCAATAAA
>probe:Drosophila_2:1630138_at:222:227; Interrogation_Position=79; Antisense; AAGGCTCAGAGCTTAAATTGCACCA
>probe:Drosophila_2:1630138_at:581:245; Interrogation_Position=94; Antisense; AATTGCACCAGGCTTCGAGAAAATT

Paste this into a BLAST search page for me
GAGAAAATTGTCGTCCTTGCACCCGGCCGCTTGGTGGATCCTATTAACGAGATCCTATTAACGACCTGGAATTCAAAATGCGGTATCTGTGCGTTTTTTCTGCGAAAATCATGAAACCCGACTGGAAACCCGACTGGATTGCGAGAATGTGAATGTGGCTAGACTAACAGGCATGCTAACAGGCATGAGACGGATTCGTTGTATCTGTGCGTTTTTTCCTTAACAGGATTCGTTGATTTTTCTTAGCTCTTTCCTTAACACTTATCCTTTGCTGCTTATCCTTTGCTGCCTTTCAATAAAAAGGCTCAGAGCTTAAATTGCACCAAATTGCACCAGGCTTCGAGAAAATT

Full Affymetrix probeset data:

Annotations for 1630138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720