FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630140_at:

>probe:Drosophila_2:1630140_at:190:605; Interrogation_Position=117; Antisense; TGATTTTTTGACTTCGCATCCCAGT
>probe:Drosophila_2:1630140_at:423:693; Interrogation_Position=144; Antisense; TTTGCACAACTCCACGATGATCATG
>probe:Drosophila_2:1630140_at:27:37; Interrogation_Position=163; Antisense; ATCATGTCGCCGCAAGTGTCCAGAA
>probe:Drosophila_2:1630140_at:238:395; Interrogation_Position=188; Antisense; GAAATCCCTCAGACATGGACAGTCC
>probe:Drosophila_2:1630140_at:77:417; Interrogation_Position=216; Antisense; GAGCGAGCCGATCCGTATAACTTTT
>probe:Drosophila_2:1630140_at:318:509; Interrogation_Position=250; Antisense; GTGCACCGTGCCATGGACTGGAGTC
>probe:Drosophila_2:1630140_at:12:527; Interrogation_Position=282; Antisense; GGGCAATCAAATTCCCGATCGCAAG
>probe:Drosophila_2:1630140_at:38:207; Interrogation_Position=304; Antisense; AAGCGCATTGCTGCGGATCGCAATC
>probe:Drosophila_2:1630140_at:295:201; Interrogation_Position=363; Antisense; AACGCCGGCTATCAGCATTGGCCAG
>probe:Drosophila_2:1630140_at:288:361; Interrogation_Position=40; Antisense; GCAAGTGTCGTGCAGCAATCAGCTA
>probe:Drosophila_2:1630140_at:217:77; Interrogation_Position=467; Antisense; AGGAGATATCTTTGTCCAGCGCCAG
>probe:Drosophila_2:1630140_at:144:43; Interrogation_Position=530; Antisense; ATCGACATTTAATCAGCACCAGCAG
>probe:Drosophila_2:1630140_at:508:239; Interrogation_Position=56; Antisense; AATCAGCTAGTATCAGTCCCCAGGA
>probe:Drosophila_2:1630140_at:30:499; Interrogation_Position=562; Antisense; GTCTCGGATTTCTCAGATGCCAATG

Paste this into a BLAST search page for me
TGATTTTTTGACTTCGCATCCCAGTTTTGCACAACTCCACGATGATCATGATCATGTCGCCGCAAGTGTCCAGAAGAAATCCCTCAGACATGGACAGTCCGAGCGAGCCGATCCGTATAACTTTTGTGCACCGTGCCATGGACTGGAGTCGGGCAATCAAATTCCCGATCGCAAGAAGCGCATTGCTGCGGATCGCAATCAACGCCGGCTATCAGCATTGGCCAGGCAAGTGTCGTGCAGCAATCAGCTAAGGAGATATCTTTGTCCAGCGCCAGATCGACATTTAATCAGCACCAGCAGAATCAGCTAGTATCAGTCCCCAGGAGTCTCGGATTTCTCAGATGCCAATG

Full Affymetrix probeset data:

Annotations for 1630140_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720